{ "ocid": "ocds-x-licitia-la-12-nck-012nck001-i-8-2023", "id": "LA-12-NCK-012NCK001-I-8-2023", "date": "2025-11-05T05:16:02.662Z", "language": "es", "initiationType": "tender", "tag": [ "tender", "award", "contract" ], "parties": [ { "id": "INNN", "name": "INNN", "roles": [ "buyer" ] }, { "id": "BRI BIORESEARCH SA DE CV", "name": "BRI BIORESEARCH SA DE CV", "roles": [ "supplier" ] }, { "id": "ABALAT SA DE CV", "name": "ABALAT SA DE CV", "roles": [ "supplier" ] }, { "id": "ABYNTECH SA DE CV", "name": "ABYNTECH SA DE CV", "roles": [ "supplier" ] }, { "id": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "name": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "roles": [ "supplier" ] }, { "id": "BECTON DICKINSON DE MEXICO SA DE CV", "name": "BECTON DICKINSON DE MEXICO SA DE CV", "roles": [ "supplier" ] }, { "id": "BOVINE & BIOLOGY SA DE CV", "name": "BOVINE & BIOLOGY SA DE CV", "roles": [ "supplier" ] }, { "id": "BRENDA PAOLA CUELLAR RIVERA", "name": "BRENDA PAOLA CUELLAR RIVERA", "roles": [ "supplier" ] }, { "id": "CIENTIFICA SENNA SA DE CV", "name": "CIENTIFICA SENNA SA DE CV", "roles": [ "supplier" ] }, { "id": "COMERCIAL BIOMEDICO JR SA DE CV", "name": "COMERCIAL BIOMEDICO JR SA DE CV", "roles": [ "supplier" ] }, { "id": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "roles": [ "supplier" ] }, { "id": "COMPAÑIA VILAB SA DE CV", "name": "COMPAÑIA VILAB SA DE CV", "roles": [ "supplier" ] }, { "id": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "name": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "roles": [ "supplier" ] }, { "id": "CORPORATIVO FARMACEUTICO GEPHAM SA DE CV", "name": "CORPORATIVO FARMACEUTICO GEPHAM SA DE CV", "roles": [ "supplier" ] }, { "id": "DIAGNOCELL LABORATORIOS SA DE CV", "name": "DIAGNOCELL LABORATORIOS SA DE CV", "roles": [ "supplier" ] }, { "id": "DISTRIBUIDORA BIOGAMA SA DE CV", "name": "DISTRIBUIDORA BIOGAMA SA DE CV", "roles": [ "supplier" ] }, { "id": "EQUIVER SA DE CV", "name": "EQUIVER SA DE CV", "roles": [ "supplier" ] }, { "id": "JRL SUPPLIERS S DE RL DE CV", "name": "JRL SUPPLIERS S DE RL DE CV", "roles": [ "supplier" ] }, { "id": "MAYIMEX SA DE CV", "name": "MAYIMEX SA DE CV", "roles": [ "supplier" ] }, { "id": "PEGO MEDICAL SA DE CV", "name": "PEGO MEDICAL SA DE CV", "roles": [ "supplier" ] }, { "id": "QUIMICA VALANER SA DE CV", "name": "QUIMICA VALANER SA DE CV", "roles": [ "supplier" ] }, { "id": "REACTIVOS Y MARCAS DE MEXICO SA DE CV", "name": "REACTIVOS Y MARCAS DE MEXICO SA DE CV", "roles": [ "supplier" ] }, { "id": "SILVERA CIENCIA E INGENIERIA SA DE CV", "name": "SILVERA CIENCIA E INGENIERIA SA DE CV", "roles": [ "supplier" ] }, { "id": "SOLUCIONES MEDICAS DIGITALES URBA SA DE CV", "name": "SOLUCIONES MEDICAS DIGITALES URBA SA DE CV", "roles": [ "supplier" ] }, { "id": "TECNOLOGIA MEDICA DIART SA DE CV", "name": "TECNOLOGIA MEDICA DIART SA DE CV", "roles": [ "supplier" ] }, { "id": "TECROM SA DE CV", "name": "TECROM SA DE CV", "roles": [ "supplier" ] } ], "buyer": { "id": "INNN", "name": "INNN" }, "tender": { "id": "LA-12-NCK-012NCK001-I-8-2023", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "description": "LICITACIÓN PÚBLICA INTERNACIONAL ELECTRÓNICA A TIEMPOS RECORTADOS PARA LA ADQUISICIÓN DE: SUSTANCIAS QUÍMICAS, REACTIVOS Y MATERIAL DE LABORATORIO", "status": "complete", "procurementMethod": "open", "procurementMethodDetails": "LICITACIÓN PÚBLICA", "awardCriteriaDetails": "BINARIO", "mainProcurementCategory": "goods", "tenderPeriod": { "startDate": "2023-10-14T05:07:02.000Z", "endDate": "2023-11-03T22:00:00.000Z" }, "awardPeriod": { "endDate": "2023-11-13T15:30:00.000Z" }, "items": [ { "id": "0", "description": "ANTICUERPO SECUNDARIO ACOPLADO A HRP ANTI-RATÓN 1ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4600, "currency": "MXN" } } }, { "id": "0", "description": "IGG ANTI CONEJO FITC DE CABRA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2600, "currency": "MXN" } } }, { "id": "0", "description": "PE ANTI-HUMAN CD25 ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2280, "currency": "MXN" } } }, { "id": "0", "description": "PE ANTI-MOUSE CD279 (PD-1) ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3820, "currency": "MXN" } } }, { "id": "0", "description": "PE/CYANINE7 ANTI-MOUSE CD274 (B7-H1, PD-L1) ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5660, "currency": "MXN" } } }, { "id": "0", "description": "PERCP MOUSE IGG1, ¿ ISOTYPE CTRL ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2780, "currency": "MXN" } } }, { "id": "0", "description": "100 BP DNA LADDER", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 780, "currency": "MXN" } } }, { "id": "0", "description": "AGUA LIBRE DE DNA Y RNA, PARA BIOLOGÍA MOLECULAR 500ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 440, "currency": "MXN" } } }, { "id": "0", "description": "CHAMALEON VUE PRE-STAINED PROTEIN LADDER", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3440, "currency": "MXN" } } }, { "id": "0", "description": "DNA LADDER (1 KB) VIAL DE 500 µL P/BIOL. MOL. SOL 10 MM TRIS HCL (PH 8.0) 1", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 780, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA POWERTRACK SYBR GREEN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6560, "currency": "MXN" } } }, { "id": "0", "description": "PROTEÍNA A/G SEFAROSA PARA INMUNOPRECIPITAR 5ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12480, "currency": "MXN" } } }, { "id": "0", "description": "REVERTAID REVERSE TRANSCRIPTASE (200 U/UL)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7020, "currency": "MXN" } } }, { "id": "0", "description": "RNASA GRADO BIOLOGÍA MOLECULAR 50MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 320, "currency": "MXN" } } }, { "id": "0", "description": "CELL LYSIS-M BUFFER.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2920, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DMEM F-12, CON GLUTAMAX", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 800, "currency": "MXN" } } }, { "id": "0", "description": "FGF8 RECOMBINANTE HUMANO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2740, "currency": "MXN" } } }, { "id": "0", "description": "FGF-BÁSICO HUMANO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2740, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE EAGLE MODIFICADO POR DUBELCO (DMEM), CON GLUTAMINA, GLUCOSA ALTA.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 620, "currency": "MXN" } } }, { "id": "0", "description": "POLI-L-LISINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1120, "currency": "MXN" } } }, { "id": "0", "description": "ELISA KIT FOR AMYLOID BETA PEPTIDE 1-40 (AB1-40), UOM 96T*5,", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11260, "currency": "MXN" } } }, { "id": "0", "description": "ALLTAQ MASTER MIX KIT (500)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3120, "currency": "MXN" } } }, { "id": "0", "description": "HUMAN IL-35(INTERLEUKIN 35) ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12300, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELISA PARA DETECTAR KLOTHO EN RATON", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12600, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELISA PARA DETECTAR KLOTHO HUMANO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12300, "currency": "MXN" } } }, { "id": "0", "description": "KIT ELISA IL-1-¿ PARA RATA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8680, "currency": "MXN" } } }, { "id": "0", "description": "KIT P/ELISA IL-10 P/RATA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8820, "currency": "MXN" } } }, { "id": "0", "description": "KIT TNF-¿ DE RATA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9780, "currency": "MXN" } } }, { "id": "0", "description": "RAT IFN-GAMMA ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8800, "currency": "MXN" } } }, { "id": "0", "description": "RAT IL-4 ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9280, "currency": "MXN" } } }, { "id": "0", "description": "RAT IL6 ELISA KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8820, "currency": "MXN" } } }, { "id": "0", "description": "ENFRIADOR PARA TUBOS DE 1.5 ML CON CAPACIDAD PARA 12 TUBOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 500, "currency": "MXN" } } }, { "id": "0", "description": "ENFRIADOR PARA TUBOS DE 1.5 ML CON CAPACIDAD PARA 32 TUBOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 580, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA ENFRIADORA PARA TUBOS DE 0.2 CON CAPACIDAD PARA 96 TUBOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 580, "currency": "MXN" } } }, { "id": "0", "description": "IMMUN-BLOT MEMBRANA DE PVDF", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 16260, "currency": "MXN" } } }, { "id": "0", "description": "RESERVORIOS DE POLIESTIRENO PARA PIPETA MULTICANAL. CAPACIDAD 100 MILILITROS.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 840, "currency": "MXN" } } }, { "id": "0", "description": "TAPA OPTICA EN TIRA DE 8 P/TIRAS DE TUBOS DE 0.2 ML PARA PCR", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2420, "currency": "MXN" } } }, { "id": "0", "description": "TAPÓN DE SELLO", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1620, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS PARA CITOMETRÌA DE FLUJO DE POLIESTIRENO, ESTÈRILES VOL.5ML 12X75MM CON TAPÒN", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1580, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS DE PCR DE 8 TIRAS CON TAPONES INDIVIDUALES ADJUNTOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1420, "currency": "MXN" } } }, { "id": "0", "description": "HRP CONJUGATE SUBSTRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6640, "currency": "MXN" } } }, { "id": "0", "description": "SUSTRATO QUIMIOLUMINISCENTE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 13280, "currency": "MXN" } } }, { "id": "0", "description": "BV421 MOUSE ANTI-TCF1 50UG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8447, "currency": "MXN" } } }, { "id": "0", "description": "BV510 MOUSE ANTI LY108 50UG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11155, "currency": "MXN" } } }, { "id": "0", "description": "CYTOKINE & CHEMOKINE CONVENIENCE PROCARTAPLEX HUMAN INFLAMMATION PANEL (20PLEX).", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 69634, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN HAE III", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1756, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN SSP I", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5054, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 100-1000 PB EN ESCALERA DE 100 PB", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1522, "currency": "MXN" } } }, { "id": "0", "description": "SUSTRATO QUIMIOLUMINISCENTE SUPERSIGNAL™ WEST PICO PLUS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5806, "currency": "MXN" } } }, { "id": "0", "description": "TAQMANUNIV MMIX", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11567, "currency": "MXN" } } }, { "id": "0", "description": "TGF-BETA 3 RECOMBINANTE HUMANO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5067, "currency": "MXN" } } }, { "id": "0", "description": "APO-BRDU", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 13758, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO RPMI 1640, EN POLVO. 10 X. CAJA CON 10 SOBRES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1052, "currency": "MXN" } } }, { "id": "0", "description": "VECTASHIELD MEDIO DE MONTAJE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4293, "currency": "MXN" } } }, { "id": "0", "description": "IL-10 HUMAN ELISA KIT, HIGH SENSITIVITY 96 TEST", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10802, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO 2-3 PIRINEDICARBOXIL PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5220, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO 2-TIOBARBITÚRICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 47300, "currency": "MXN" } } }, { "id": "0", "description": "ÀCIDO CLOROACÈTICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 48360, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO DIHIDROFENILACÉTICO DOPAC PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 27660, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO KAINICO MONOHIDRATADO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 97500, "currency": "MXN" } } }, { "id": "0", "description": "[KO VALIDATED] LAMIN A/C RABBIT MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 164400, "currency": "MXN" } } }, { "id": "0", "description": "PE ANTI-MOUSE CD3 ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12150, "currency": "MXN" } } }, { "id": "0", "description": "PERCP ANTI-HUMAN CD279 (PD-1)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 27760, "currency": "MXN" } } }, { "id": "0", "description": "RHODAMINE RED-X-AAFFINI PURE GOAT ANTI-RABBIT IGG (H+L)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14750, "currency": "MXN" } } }, { "id": "0", "description": "RHODAMINE RED-X-CONJUGATED AFFINIPURE GOAT ANTI-HUMAN IGG (H+L)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15200, "currency": "MXN" } } }, { "id": "0", "description": "DUAL LUCIFERASE REPORTER ASSAY SYSTEM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 51904.2, "currency": "MXN" } } }, { "id": "0", "description": "GDNF PROTEÍNA RECOMBINANTE HUMANA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 99000, "currency": "MXN" } } }, { "id": "0", "description": "DEOXICOLATO DE SODIO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 13600, "currency": "MXN" } } }, { "id": "0", "description": "PEROXIDASE IN SITU APOPTOSIS DETECTION KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 89150, "currency": "MXN" } } }, { "id": "0", "description": "BICINCHONINIC ACID KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 13000, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA GLUCOSA FOSFATO ISOMERASA, 100 PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8064, "currency": "MXN" } } }, { "id": "0", "description": "KIT PEROXIDASE MOUSE & RABBIT, READY TO USE 1000 TESTS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 47532, "currency": "MXN" } } }, { "id": "0", "description": "BROWNIEE AQUAPORE ODS RP-18 NEWGUARD CARTRIDGE, 7 UM 15X3.2 MM", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 20040, "currency": "MXN" } } }, { "id": "0", "description": "COLUMNA PARA CROMATOGRAFÍA ADSORBOSPHERE OPA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 28000, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANA DE NITRATO DE CELULOSA DE 0.45¿M DEL PORO. DIÁMETRO DE 47MM.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2404.8, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANAS DE FILTRADO HIDROFÍLICAS DE PTFE, 0.45 MICRAS DE PORO Y 45 O 47 MM DE DIÁMETRO, CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3768, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL ALUMINIO GRUESO EN ROLLO JUMBO", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1800, "currency": "MXN" } } }, { "id": "0", "description": "PLACAS DE VIDRIO CORTAS DE 10.01X7.3 CM PARA PREPARAR GELES DE ELECTROFORESIS", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 9200, "currency": "MXN" } } }, { "id": "0", "description": "ROLLO DE MEMBRANA PVDF PARA WESTERN BLOT 0.2 µM, 26 CM X 3.3 M", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3996, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE GRAFITO TRANSVERSO COMPATIBLES CON ESPECTRO DE ABSORCIÓN ATÓMICA PE AA600 CAJA CON 5", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 89600, "currency": "MXN" } } }, { "id": "0", "description": "ZORBAX ECLIPSE XBD-C18", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 60640, "currency": "MXN" } } }, { "id": "0", "description": "2-ARAQUIDONOILGLICEROL(2AG) 2-ARACHIDONOYL GLYCEROL SIGMA870450 FRASCO DE 5 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 31840, "currency": "MXN" } } }, { "id": "0", "description": "3-NITROPROPANOIC ACID", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 16080, "currency": "MXN" } } }, { "id": "0", "description": "4-HYDROXYNONENAL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 27520, "currency": "MXN" } } }, { "id": "0", "description": "ALBUMINA DE SUERO BOVINO (BSA) LIBRE DE IGGS Y LIOFILIZADA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 544800, "currency": "MXN" } } }, { "id": "0", "description": "CESIUM METHANESULFONATE, USED IN PATCH", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7040, "currency": "MXN" } } }, { "id": "0", "description": "CITOCROMO C DE CORAZÓN BOVINO, FRASCO 50 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10176, "currency": "MXN" } } }, { "id": "0", "description": "CP-55940", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 45056, "currency": "MXN" } } }, { "id": "0", "description": "ELCUBRAGISTAT  (SYNONYMS: ABX-1431)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 157760, "currency": "MXN" } } }, { "id": "0", "description": "EM PROTEÍN-A/ GOLD, 25 NM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 37880, "currency": "MXN" } } }, { "id": "0", "description": "ERITROSINA B", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3120, "currency": "MXN" } } }, { "id": "0", "description": "GELATINA DE PIEL DE CERDO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4480, "currency": "MXN" } } }, { "id": "0", "description": "GLUCOSE 6-PHOSPHATE DEHYDROGENASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7412, "currency": "MXN" } } }, { "id": "0", "description": "GUINEA PIG LIVER ACETONE TISSUE (POLVO DE HÍGADO) FCO. 1 G.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 26000, "currency": "MXN" } } }, { "id": "0", "description": "HISTIDINE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 21760, "currency": "MXN" } } }, { "id": "0", "description": "METHOXYPOLYETHYLENE GLYCOL AMINE (PEG AMINA)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15488, "currency": "MXN" } } }, { "id": "0", "description": "N,N-DIMETHYL-4-NITROSOANILINE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3776, "currency": "MXN" } } }, { "id": "0", "description": "N-ETIL-N'-(3- DIMETILAMINOPROPIL)CARBODIIMIDA HYDROCHLORIDE (EDAC)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7004, "currency": "MXN" } } }, { "id": "0", "description": "PARAFORMALDEHÍDO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1843.2, "currency": "MXN" } } }, { "id": "0", "description": "PARAFORMALDEHÍDO GRANULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5529.6, "currency": "MXN" } } }, { "id": "0", "description": "PHTALDIALDEHIDO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 38808, "currency": "MXN" } } }, { "id": "0", "description": "POLYETHYLENIMINE MN 2100", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11232, "currency": "MXN" } } }, { "id": "0", "description": "POLY-L-LYSINE SOLUTION. (100 ML)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 22176, "currency": "MXN" } } }, { "id": "0", "description": "SAG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8024, "currency": "MXN" } } }, { "id": "0", "description": "SPAUTIN-1. =98% (HPLC)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9144, "currency": "MXN" } } }, { "id": "0", "description": "TETRAÓXIDO DE OSMIO, CRISTALINO PARA MICROSCOPÍA ELECTRONICA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2800, "currency": "MXN" } } }, { "id": "0", "description": "TRANSFERRINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 239200, "currency": "MXN" } } }, { "id": "0", "description": "XANTINA OXIDASA =99.5% (HPLC), FRASCO 5 GR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6080, "currency": "MXN" } } }, { "id": "0", "description": "CLOROQUINA DIFOSFATO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5100, "currency": "MXN" } } }, { "id": "0", "description": "ADENOSINE 5´ TRIPHOSPHATE MAGNESIUM SALT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3944, "currency": "MXN" } } }, { "id": "0", "description": "ARSENITO DE SODIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7004, "currency": "MXN" } } }, { "id": "0", "description": "2',7'-DICHLOROFLUORESCEIN DIACETATE (DIACETATO DE DICLOROFLUORESCEÍNA), FRASCO 1 GR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 60800, "currency": "MXN" } } }, { "id": "0", "description": "7-AAD VIABILITY STAINING SOLUCIÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 122400, "currency": "MXN" } } }, { "id": "0", "description": "4-NITROPHENYL PHOSPHATE DISODIUM SALT HEXAHYDRATE 5 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6980, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-HUMAN IGG (µ-CHAIN SPECIFIC) -ALKALINE PHOSPHATASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 29614, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-HUMAN IGG (¿-CHAIN SPECIFIC) -ALKALINE PHOSPHATASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 29614, "currency": "MXN" } } }, { "id": "0", "description": "LIMPIADOR DE PARAFINA DC EN SPRAY, NO TOXICO Y A BASE DE ACEITE MINERAL EN MEDIO ALCOHÓLICO (PANREAC)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 29321, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA CROMÓGENO DIAMINOBENCIDINA K3468 (DAB + CHROMOGEN)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 74716, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA LSAB - HRP SISTEMA DE DETECCIÓN K0690 (LINK Y ESTREPTAVIDINA)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 73114, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA PARA IDENTIFICACIÓN DE ENTEROBACTERIAS 20 E", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5609.5, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN DESCONTAMINANTE DE RNASAS DE SUPERFICIES, EN SPRAY (RNASEZAP)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3900, "currency": "MXN" } } }, { "id": "0", "description": "BANDA DE ESFUERZO RESPIRATORIO Z-RIP GRANDE 114-312 CMS, (SENSOR PARA RESPIRACIÓN ABDOMINAL) NECESARIO MUESTRA FISICA.", "classification": { "scheme": "CUCOP", "id": "25501-0102", "description": "EQUIPO PARA TOMA MULTIPLE" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 43257.85, "currency": "MXN" } } }, { "id": "0", "description": "DISPOSABLE 12 MM TWISTED PAIR SUBDERMAL NEEDLES DESECHABLE. PARA EQUIPO EBNEURO 64 CANALES 2.5 LONGITUD. NECESARIO MUESTRA FÍSICA", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 33614, "currency": "MXN" } } }, { "id": "0", "description": "DISPOSABLE 12 MM TWISTED PAIR SUBDERMAL NEEDLES DESECHABLE. PARA EQUIPO EBNEURO 64 CANALES. 2.0 DE LONGITUD. NECESARIO MUESTRA FÍSICA", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 48924, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODO CON PARCHE ADHESIVO (TWO CHANNEL LARYNGEAL SUFARCE ELECTRO DE DRAGONFLY) LSE500DCS NECESARIO MUESTRA FISICIA", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 33614, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DESECHABLES DE INSERCIÓN, CUBIERTA DE ORO ER326A (AUDIFONOS DE INSERCIÓN)", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 7381, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DESECHABLES DE INSERCIÓN, CUBIERTA DE ORO ER326B (AUDIFONOS DE INSERCIÓN)", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 7381, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DESECHABLES INSERT EARPHONES, TAM. 3 A. (AUDIFONOS DE INSERCIÓN)", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3214, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DESECHABLES INSERT EARPHONES, TAM. 3 B. (AUDIFONOS DE INSERCIÓN)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3214, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS KENDAL MEDI-TRACE EGC. ELECTRODOS CONDUCTORES ADHESIVOS PARA EGK KENDAL MEDI-TRACE 100. EQUIPO PROPIEDAD DEL INNN", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 700, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS KENDAL MEDI-TRACE EGC. PARA ESTUDIOS PSG CON CONECTOR DE BROCHE", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 700, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS TIMPÁNICO PARA ELECTROCOCLEOGRAFÍA N° PARTE 8049550 PARA EQUIPO PARA EQUIPO ECLIPSE PROPIEDAD DEL INNN", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 124800, "currency": "MXN" } } }, { "id": "0", "description": "FLEXI WRAP TAPES DESECHABLES PARA SENSOR SPO2, CINTA PARA FIJACION DE OXIMETRO DE PULSO DESECHABLE TAMAÑO ADULTO. NECESARIO MUESTRA FISICA", "classification": { "scheme": "CUCOP", "id": "25501-0094", "description": "SENSOR OPTICO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 7560, "currency": "MXN" } } }, { "id": "0", "description": "GUANTES DE NITRILO,NEGRO, DESECHABLES, AMBIDIESTRO TAMAÑO GRANDE", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 189, "currency": "MXN" } } }, { "id": "0", "description": "JUEGO DE OLIVAS PARA IMPEDANCIOMETRO MARCA MADSEN, MOD. ZODIAC 901 EQUIPO PROPIEDAD DEL INNN CAT. 8-69-29601", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 11824, "currency": "MXN" } } }, { "id": "0", "description": "LAMINILLA CON REJILLAS PARA ORINA (GLASSTIC SLIDE 10 WITH GRIDS)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 38921, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 2000 ML, VIDRIO", "classification": { "scheme": "CUCOP", "id": "25501-0024", "description": "MATRAZ" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 800, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ ERLENMEYER DE VIDRIO CON TAPÓN DE ROSCA DE 100 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024", "description": "MATRAZ" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 250, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ ERLENMEYER DE VIDRIO CON TAPÓN DE ROSCA DE 250 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024", "description": "MATRAZ" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 290, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS DE PLASTICO PARA TRANSFERENCIA DE UN SOLO PASO LIBRE DE DECANTACIÓN DESPUES DE CENTRIFUGACION PARA TUBO CONICO DE 12 ML PARA RETENER 1.0 ML DE ORINA MARCA KOVA REF. HY 87135", "classification": { "scheme": "CUCOP", "id": "25501-0031", "description": "PIPETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 29306, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM CON TEJIDO CONTROL POSITIVO PARA HONGOS", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 30920, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CITOQUERATINA PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 58200, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE AMIGDALA PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 29100, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE APENDICE PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 29100, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE GANGLIO PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE OVARIO PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PANCREAS PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 29100, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PIEL PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 29100, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE PLACENTA PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 29100, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE TUMORES GERMINALES PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL DE UTERO PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 29100, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA ALFA FETOPROTEINA PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA ATRX PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA BHGC PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CEA PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA CITOMEGALOVIRUS PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 29100, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA EMA PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA HERPES VIRUS PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA IDH1 R132H PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA KI67 PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA OLIG 2 PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA PLACAS DE AMILODE PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 31321, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA PLAP PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA SINAPTOFISINA PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA TOXOPLASMA PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA VIMENTINA PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 32300, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 25 X 75 MM DE VIDRIO CON TEJIDO CONTROL POSITIVO PARA VIRUS EPSTEIN BARR PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 31800, "currency": "MXN" } } }, { "id": "0", "description": "SENSOR DE CO2 A PRUEBA DE GOLPES Y AGUA PARA MONITOR DE TRASLADO PARA SIGNOS VITALES. MARCA NIHON KOHDEN MODELO VISMOCATALOGO PVM-4763K", "classification": { "scheme": "CUCOP", "id": "25501-0094", "description": "SENSOR OPTICO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 28109, "currency": "MXN" } } }, { "id": "0", "description": "SENSOR DE DEDO PARA SPO2. MONITOR CARE SCAPE. GE. NO. PARTE TS-SA-D", "classification": { "scheme": "CUCOP", "id": "25501-0094", "description": "SENSOR OPTICO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 18994, "currency": "MXN" } } }, { "id": "0", "description": "SET DE CABLES PINCH (8500410)", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 9800, "currency": "MXN" } } }, { "id": "0", "description": "SET DE ELECTRODOS SUBDERMICOS DE DOS CANALES MEDTRONIC XOMED PARA EQUIPO DE MONITOREO DE FACIAL EQUIPO PROPIEDAD DEL INNN", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 13800, "currency": "MXN" } } }, { "id": "0", "description": "TAPA PARA TUBO CONICO PARA EGO MARCA KOVA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 29306, "currency": "MXN" } } }, { "id": "0", "description": "25501-0096 INFRARROJO SIN CONTACTO TIPO PISTOLA PARA USO HOSPITALARIO Y TOMAS CONTINUAS CON RANGO DE TEMPERATURA DE 32° A 42° C CON PRECISIÓN DE 0.3°C Y RESOLUCIÓN DE 0.1°C", "classification": { "scheme": "CUCOP", "id": "25501-0096", "description": "TERMOMETRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 850, "currency": "MXN" } } }, { "id": "0", "description": "TUBO CONICO PARA EGO DE 12 ML MARCA KOVA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 29306, "currency": "MXN" } } }, { "id": "0", "description": "VASOS PARA HISTOQUINETTE DE VIDRIO", "classification": { "scheme": "CUCOP", "id": "25501-0052", "description": "VASO PRECIPITADO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 23600, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-HUMAN CD3 ACOPLADO A ALEXA FLUOR 488", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4399.04, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI GCLC RABBIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7402.4, "currency": "MXN" } } }, { "id": "0", "description": "ANTIBODY ANTI GFAP", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2942.81, "currency": "MXN" } } }, { "id": "0", "description": "ANTIBODY ANTI HIF-1 ALPHA MOUSE MAB (D5F3M)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8753.6, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI 1L-1 BETA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6507.55, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI 1L-6", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6507.55, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI KLOTHO DE HUMANO Y RATON", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6340.69, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-CABRA-PE.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5657.12, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-MOUSE IGG-TRITC.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4990.64, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CALPAIN 3", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6325.52, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO GROWTH HORMONE ANTIBODY (N1C3)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7417.7, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PROLACTIN ANTIBODY (N1C3)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7144.66, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO VS BAX", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6507.55, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO VS CASPASA 9 (C9)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7235.66, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-NF-KB P65 ANTIBODY PRODUCED IN RABBIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8233.69, "currency": "MXN" } } }, { "id": "0", "description": "APC MOUSE ANTI-HUMAN CD25 CLONE 2A3 (RUO (GMP))", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5172.67, "currency": "MXN" } } }, { "id": "0", "description": "ANTIBODY CASPASE 8 - RABBIT PAB", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6446.87, "currency": "MXN" } } }, { "id": "0", "description": "CD11B POLYCLONAL ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6371.03, "currency": "MXN" } } }, { "id": "0", "description": "MONOCLONAL ANTI-S100B ANTIBODY PRODUCED IN MOUSE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7859.1, "currency": "MXN" } } }, { "id": "0", "description": "PHOSPHO-ULK1 (SER317) ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6355.86, "currency": "MXN" } } }, { "id": "0", "description": "RECOMBINANT ANTI-BDNF ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6386.2, "currency": "MXN" } } }, { "id": "0", "description": "TNFA - ANTICUERPO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6583.39, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN BAMHI HF", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1406.84, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN ECORV HF", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1682.68, "currency": "MXN" } } }, { "id": "0", "description": "ENSAYO TAQMAN PARA DETECCION DE RNAM DEL GEN KLOTHO EN RATON SONDA FAM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10001.47, "currency": "MXN" } } }, { "id": "0", "description": "ENSAYO TAQMAN PARA DETECCION DE RNAM DEL GEN SLC38A3 EN RATON SONDA FAM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10001.47, "currency": "MXN" } } }, { "id": "0", "description": "ENSAYO TAQMAN C_1202883_20 MTHFR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6264.26, "currency": "MXN" } } }, { "id": "0", "description": "ENSAYO TAQMAN C_850486_20 MTHFR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6264.26, "currency": "MXN" } } }, { "id": "0", "description": "ENSAYO TAQMAN PARA DETECCION DE RNAM DEL GEN KLOTHO EN HUMANO SONDA FAM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10001.47, "currency": "MXN" } } }, { "id": "0", "description": "ENSAYO TAQMAN PARA LA DETECCION DE RNAM DEL GEN SLC38A1 SONDA FAM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10001.47, "currency": "MXN" } } }, { "id": "0", "description": "ENSAYO TAQMA RNASAP, SONDA VIC DYE/QSY, LIMITADO POR CEBADORES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5600.14, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN HHA I", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1655.02, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN MBOII", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1264.22, "currency": "MXN" } } }, { "id": "0", "description": "ESP3I (BSMBI) (10 U/µL)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6969.5, "currency": "MXN" } } }, { "id": "0", "description": "GENESCAN 500 LIZ SIZE STANDARD FOR SIZING DNA FRAGMENTS IN THE 35-500 NUCLEOTIDES RANGE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9107, "currency": "MXN" } } }, { "id": "0", "description": "GLICINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1245.83, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE PERLAS MAGNÉTICAS PARA AISLAMIENTO DE ADN Y ARN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5971.06, "currency": "MXN" } } }, { "id": "0", "description": "MASTER MIX PARA 100 REACCIONES DE PCR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2335.42, "currency": "MXN" } } }, { "id": "0", "description": "PROTEÍNA KLOTHO HUMANA RECOMBINANTE (ACTIVA)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3748.55, "currency": "MXN" } } }, { "id": "0", "description": "QUICK-GDNA MINIPREP, 200 PREPS.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9320.12, "currency": "MXN" } } }, { "id": "0", "description": "RNA CLEAN & CONCENTRATOR-5 (DNASE NOT INCLUDED)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11994.54, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER, SCA2A; 6FAM GGG CCC CTC ACC ATG TCG 3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER; SCA17F; 5´-FAM-GCC AGC GCA CTC ACC CTC-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER; TBP-F; 5´-5¨-FAM-GACCCCACAGCCTATTCAGA-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; MJD52; 5´-VIC-CCA GTC ACT ACT TTG ATT CG-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 22MER; JPH3F; 5´- FAM-GGTTCCCTGCACAGAAACCATC - 3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; ATN1F; 5´-FAM-CCCAGTCCACCGCCCACCCACCA -3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 24 MER; SCA10TPF; 5´-6-FAM-CAG ATG GCA GAA TGA TAA ACT CAA-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 30 MER; EHF; 5´-56FAM ATGAAG GCC TTC GAG TCC CTC AAG TCC TTC-3'", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 30 MER; EHR; 5´GGC GGT GGC GGC TGT TGC TGC TGC TGC TGC - 3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 46 MER; SCA10TPR1; 5´-TACGCATCCCAGTTTGAGACGAGAATAGAATAGAATAGAATAGAAT-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO DE 20 MER; SCA7F; 5'-PET-TAG GAG CGG AAA GAA TGT CG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS 25 MER, APOE-R; 5'-ACAGAATTCGCCCCGGCCTGGTACACTGCCA-3'", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381.82, "currency": "MXN" } } }, { "id": "0", "description": "TAQ POLIMERASA DE ARRANQUE EN CALIENTE 5U/¿L, 500U", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2004.42, "currency": "MXN" } } }, { "id": "0", "description": "TAQ POLIMERASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1615.68, "currency": "MXN" } } }, { "id": "0", "description": "TAQMAN GENOTYPING MASTER MIX 10 ML. CAT. 4371355", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 17371.75, "currency": "MXN" } } }, { "id": "0", "description": "TAQMAN RNASE P INSTRUMENT VERIFICATION PLATE, FAST 48-WELL.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8859.38, "currency": "MXN" } } }, { "id": "0", "description": "DMEM, POWDER, HIGH GLUCOSE, 10 X 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1098.72, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO NEUROBASAL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1710.19, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO OPTIMEM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10261.17, "currency": "MXN" } } }, { "id": "0", "description": "ESSENTIAL 8 MEDIUM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5222.53, "currency": "MXN" } } }, { "id": "0", "description": "CELL PERMEANT.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15745.54, "currency": "MXN" } } }, { "id": "0", "description": "LIPOFECTAMIN 30000", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15115.91, "currency": "MXN" } } }, { "id": "0", "description": "MATRIZ DE LA MEMBRANA BASAL DE FACTOR DE CRECIMIENTO REDUCIDO LISTA PARA USAR Y CUALIFICADA PARA HESC", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1815.9, "currency": "MXN" } } }, { "id": "0", "description": "MATRIGEL GROWTH FACTOR REDUCED (GFR) BASEMENT MEMBRANE MATRIX, LDEV-FREE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1815.9, "currency": "MXN" } } }, { "id": "0", "description": "SUPLEMENTO B27", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2887.1, "currency": "MXN" } } }, { "id": "0", "description": "SUPLEMENTO B-27 (50X) SIN VITAMINA A", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2850.33, "currency": "MXN" } } }, { "id": "0", "description": "SUPLEMENTO N2 (100X)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2022.81, "currency": "MXN" } } }, { "id": "0", "description": "TRIPSINA-EDTA (0.25% TRIPSINA, EDTA•4NA) (1X),", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 323.98, "currency": "MXN" } } }, { "id": "0", "description": "TRYPLE EXPRESS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1857.31, "currency": "MXN" } } }, { "id": "0", "description": "CYCLE SEQUENCING KIT (100 REACTIONS) WITH BUFFER TUBE 5X SEQ", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 26450.02, "currency": "MXN" } } }, { "id": "0", "description": "CYCLE SEQUENCING KIT, 24 REACTIONS.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7808.53, "currency": "MXN" } } }, { "id": "0", "description": "CONJUNTO DE TAMPONES DE TINCIÓN DE FACTOR DE TRANSCRIPCIÓN/FOXP3", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3318.9, "currency": "MXN" } } }, { "id": "0", "description": "DAB SUBSTRATE KIT PEROXIDASE (HRP) WITH NICKEL, (3,3-DIAMINOBENZIDINE)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3733.01, "currency": "MXN" } } }, { "id": "0", "description": "EPITECT BISULFITE KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2442.54, "currency": "MXN" } } }, { "id": "0", "description": "INSULIN MOUSE ELISA KIT 96 TEST", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10849.62, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ENSAYO DE PROTEÍNAS BCA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2905.5, "currency": "MXN" } } }, { "id": "0", "description": "MITOCHONDRIAL MEMBRANE POTENTIAL KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7525.95, "currency": "MXN" } } }, { "id": "0", "description": "POTENCIADOR DE LA QUIMIOLUMINISCENCIA (ECL) PARA WESTERN BLOT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1411.34, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE CONVERSION DE DNA CON BISULFITO DE SODIO PARA EVALUAR METILACION MEDIANTE PCR", "classification": { "scheme": "CUCOP", "id": "25901-0012", "description": "SUSTANCIAS EN FORMA LIQUIDA PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25901", "description": "OTROS PRODUCTOS QUÍMICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2442.54, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE EXTRACCIÓN DE DNA DE TEJIDO EMBEBIDO EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3453.24, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE EXTRACCIÓN DE RNA DE TEJIDO EMBEBIDO EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8183.19, "currency": "MXN" } } }, { "id": "0", "description": "TRIZOL PARA EXTRACCIÓN DE RNA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5356.73, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACIO CON ANTICOAGULANTE CITRATO (TAPÓN AZUL) 2.7 ML. DE PLÁSTICO, DESECHABLE, CON TAPÓN DE SEGURIDAD Y VOLUMEN DE DRENADO AJUSTADO AL ALTIPLANO MEXICANO. SE SUGIERE MARCA BD VACUTAINER PLUS.", "classification": { "scheme": "CUCOP", "id": "25501-0048", "description": "TUBO MUESTRADOR" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 401, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACIO SIN ANTICOAGULANTE (TAPÓN ORO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE, CON GEL SEPARADOR, CON ACTIVADOR DE LA COAGULACIÓN Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 5 ML. SE SUGIERE MARCA BD VACUTAINER PLUS.", "classification": { "scheme": "CUCOP", "id": "25501-0048", "description": "TUBO MUESTRADOR" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 382, "currency": "MXN" } } }, { "id": "0", "description": "SUERO FETAL BOVINO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7499, "currency": "MXN" } } }, { "id": "0", "description": "SUERO FETAL BOVINO, INACTIVADO CON CALOR.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9110, "currency": "MXN" } } }, { "id": "0", "description": "GENTAMICINA 80MG/ 2ML", "classification": { "scheme": "CUCOP", "id": "25301-1053", "description": "010.000.1954.00 GENTAMICINA SOLUCION INYECTABLE 80 MG AMPOLLETA CON 2 ML" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25301", "description": "MEDICINAS Y PRODUCTOS FARMACÉUTICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 428.4, "currency": "MXN" } } }, { "id": "0", "description": "HEPARINA 1000 UI/ML CAJA CON 1 FRASCO ÁMPULA DE 10 ML", "classification": { "scheme": "CUCOP", "id": "25301-1103", "description": "010.000.0621.00 HEPARINA SOLUCION INYECTABLE 10 000 UI/ 10 ML (1000 UI/ ML) 50 FRASCOS AMPULA CON 10 ML" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25301", "description": "MEDICINAS Y PRODUCTOS FARMACÉUTICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 210, "currency": "MXN" } } }, { "id": "0", "description": "ISODINE ESPUMA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 579.6, "currency": "MXN" } } }, { "id": "0", "description": "ESCARLATA DE BIEBRICH", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 629.85, "currency": "MXN" } } }, { "id": "0", "description": "ALCOHOL ETÍLICO 96% PORRON DE 20L", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1022.4, "currency": "MXN" } } }, { "id": "0", "description": "FORMALDEHIDO EN SOLUCIÓN AL 36-38%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3913.2, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, CON CAMARA DE VISUALIZACION DE FLUJO, ESTERIL Y DESECHABLE DE 22G X 1 \" ( 0.7 MM X 25 MM ) COLOR NEGRO REF. 301747", "classification": { "scheme": "CUCOP", "id": "25501-0105", "description": "AGUJA PARA TOMA MULTIPLE" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 738, "currency": "MXN" } } }, { "id": "0", "description": "CUBETAS BLANCAS DE PLASTICO CON TAPA PARA 15 LITROS, 30 CENTÍMETROS (DIÁMETRO DE LA BOCA Y 29 CENTÍMETROS (ALTURA) POLIETILENO DE BAJA DENSIDAD", "classification": { "scheme": "CUCOP", "id": "25501-0011", "description": "CUBETA DESECHO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 297.99, "currency": "MXN" } } }, { "id": "0", "description": "CUBETAS BLANCAS DE PLASTICO CON TAPA PARA 20 LITROS, 30 CENTÍMETROS (DIÁMETRO DE LA BOCA Y 36 CENTÍMETROS (ALTURA) POLIETILENO DE BAJA DENSIDAD", "classification": { "scheme": "CUCOP", "id": "25501-0011", "description": "CUBETA DESECHO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 282.1, "currency": "MXN" } } }, { "id": "0", "description": "ESTIMULADORES MONOPOLARES MEDTRONIC XOMED PARA EQUIPO DE MONITOREO DE FACIAL", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 22377.6, "currency": "MXN" } } }, { "id": "0", "description": "JUEGO DE OLIVAS PARA IMPEDANCIOMETRO INTERACUSTIC. MOD. AT 235, MED. 7, 8, 9.5, 11, 12.5, 14, 16 MM. CAT. BET25", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 6650.1, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE ELECTRODOS AUTOADHERIBLES, CON ALOE VERA Y GEL, PARA PACIENTES CON PROBLEMA DE DEGLUCION, REG 59000, COMPATIBLE CON EQUIPO VITAL SLIM PROPIEDAD DEL INNN CAJA CON 12 SOBRES CON 2 PIEZAS DCADA SOBRE", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 7200, "currency": "MXN" } } }, { "id": "0", "description": "SENSOR DE PRESIÓN/FLUJO RESPIRATORIO MAS RONQUIDO CON CONECTOR EN LLAVE PARA EQUIPO PSG PROPIEDAD DEL INNN. NECESARIO MUESTRA FÍSICA", "classification": { "scheme": "CUCOP", "id": "25501-0094", "description": "SENSOR OPTICO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 26136, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO CLORHÍDRICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 217, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO FOSFOMOLIBDICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10485, "currency": "MXN" } } }, { "id": "0", "description": "HIDROXIDO DE AMONIO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 336, "currency": "MXN" } } }, { "id": "0", "description": "ADENOSINE 5'-TRIPHOSPHATE MAGNESIUM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 955, "currency": "MXN" } } }, { "id": "0", "description": "AGUA LIBRE DE NUCLEASAS NO TRATADA CON DEPC", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3120, "currency": "MXN" } } }, { "id": "0", "description": "BROMURO DE ETIDIO P/BIOL. MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1204, "currency": "MXN" } } }, { "id": "0", "description": "FOLIN CICALTEU PARA DETERMINACION DE PROTEINAS. FCO. 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3655, "currency": "MXN" } } }, { "id": "0", "description": "TRIZMA HYDROCHLORIDE PARA BIOLOGÍA MOLECULAR,", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "ALBUMINA SÉRICA BOVINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4997, "currency": "MXN" } } }, { "id": "0", "description": "ANTIBIÓTICO-ANTIMICÓTICO (10.000 UNIDADES/ML DE PENICILINA, 10.000 µG/ML DE ESTREPTOMICINA Y 25 µG/ML DE ANFOTERICINA B )", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 700, "currency": "MXN" } } }, { "id": "0", "description": "ANTIBIÓTICO-ANTIMICÓTICO (100X) FRASCO CON 100 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 630, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DMEM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1355, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DMEM/F12", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1460, "currency": "MXN" } } }, { "id": "0", "description": "L-GLUTATHIONE REDUCED.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3275, "currency": "MXN" } } }, { "id": "0", "description": "LINEA CELULAR DE GLIOBLASTOMA M059J", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 29500, "currency": "MXN" } } }, { "id": "0", "description": "LÌNEA CELULAR RG2", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 37485, "currency": "MXN" } } }, { "id": "0", "description": "SV12 CRL-8621™ CELL LINE - FETAL GLIAL CELLS FROM HUMAN BRAIN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 37481, "currency": "MXN" } } }, { "id": "0", "description": "TRIPSINA-EDTA (0.05%) ROJO FENOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 900, "currency": "MXN" } } }, { "id": "0", "description": "DODECILSULFATO DE SODIO (SDS) PARA ELECTROFORESIS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4200, "currency": "MXN" } } }, { "id": "0", "description": "DETERGENTE ALCALINO HYCLIN PLUS ALCALINO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 371, "currency": "MXN" } } }, { "id": "0", "description": "TRITÓN X-100", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 730, "currency": "MXN" } } }, { "id": "0", "description": "TWEEN 20 100% NON-IONIC DETERGENT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 387, "currency": "MXN" } } }, { "id": "0", "description": "100 µL MICROLITER SYRINGE MODEL 710 N, CEMENTED NEEDLE, 22S GAUGE, 2 IN, POINT STYLE 3", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1645, "currency": "MXN" } } }, { "id": "0", "description": "100-WELL MICROTUBE STORAGE BOX", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 775, "currency": "MXN" } } }, { "id": "0", "description": "50ML TUBO PARA CENTRÍFUGA STANDARD ESTERIL DNASE/RNASE FREE 25 POR PAQUETE CAJA CON 500 NEST CAT.602052 NEST", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1600, "currency": "MXN" } } }, { "id": "0", "description": "CAJA DE ALMACENAMIENTO PARA 100 MICROTUBOS DE 2 ML DE BASE PLANA PARA CONGELACIÓN", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 152, "currency": "MXN" } } }, { "id": "0", "description": "CAJA DE PAPEL FILTRO . TAMAÑO DEL PORO 125 MM", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 275, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS CON INSERTO DE 12 MULTIPOZOS, PORO 3.0 µM PARA CULTIVO CELULAR", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3150, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS DE COPPLIN DE VIDRIO PARA TINCIÓNCAPACIDAD DE 500 ML CON CANASTILLA METÁLICA, CON TAPA", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3800, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS DE POLIESTIRENO DE 24 POZOS ESTÉRILES, LIBRES DE PIROGÉNOS PARA CULTIVO CELULAR", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1260, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS DE POLIESTIRENO DE 96 POZOS TRATADAS ESTÉRILES, LIBRES DE PIROGÉNOS PARA CULTIVO CELULAR", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2620, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS ESTÉRILES PARA CULTIVO CELULAR DE 100 X15 MM", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2087, "currency": "MXN" } } }, { "id": "0", "description": "CINTA TESTIGO", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 70, "currency": "MXN" } } }, { "id": "0", "description": "COLADOR CELULAR 40UM AZUL ESTERIL EMPAQUE INDIVIDUAL CAJA(S) CON 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1220, "currency": "MXN" } } }, { "id": "0", "description": "CRIOCAJAS DE ALMACENAMIENTO", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 775, "currency": "MXN" } } }, { "id": "0", "description": "CRIOTUBO ESTERIL. 2 ML \"SELF STANDING\" (CON BASE PARA COLOCAR VERTICALMENTE)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 330, "currency": "MXN" } } }, { "id": "0", "description": "CRIOTUBOS DE POLIPROPILENO, LIBRES DEPIRÓGENOS, RNASAS Y DNASAS ESTÉRILES DE 1.7 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1900, "currency": "MXN" } } }, { "id": "0", "description": "CUBREOBJETOS 24 X 24", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 35, "currency": "MXN" } } }, { "id": "0", "description": "ESTUCHE BARRAS MAGNETICAS PARA AGITACIÓN DE DIFERENTES TAMAÑOS (16 BARRAS EN TOTAL)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2750, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA ESTÉRILES CAPACIDAD 5-200 UL)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 55, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO CON 100 GRAMOS BOVINE SERUM ALBUMIN LYOPHILISED PH ~7. \tHEAT SHOCK FRACTION, PROTEASE FREE, FATTY ACID FREE, ESSENTIALLY GLOBULIN FREE =98% FRASCO CON 100 GRAMOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 5350, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO. VIDRIO TIPO SCHOTT. AUTOCLAVEABLE. BOCA ANCHA. CON TAPA. CAJA C/10 PZAS. 100 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 950, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENEIZADOR DE VIDRIO CON PISTILO DE TEFLÓN DE 2 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 5373, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENEIZADOR DE VIDRIO CON PISTILO DE TEFLÓN DE 10 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 6373, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 15 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 4662, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 1ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 4702, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENEIZADOR DOUNCE DE VIDRIO 7ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3690, "currency": "MXN" } } }, { "id": "0", "description": "INSERTOS DE CULTIVO CELULAR DE POLICARBONATO CON TAMAÑO DE PORO DE 8 MICRAS EN PLACA DE 12 POCILLOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2650, "currency": "MXN" } } }, { "id": "0", "description": "JARRA CUADRADA DE TINCIÓN PARA PORTAOBJETOS FABRICADO EN POLIPROPILENO, SUJETA A 10 LAMINILLAS, CONSECUTIVAS. DISEÑADO EN FORMA CUADRADA Y CUERPO CORTO PARA AHORRAR ESPACIO Y SOLUCIÓN DE TINCIÓN. CUANDO SE QUITA LA TAPA, LOS PORTAOBJETOS SE PUEDEN MANIPULAR SIN TOCAR LA SOLUCIÓN. LA TAPA DE ROSCA TIENE UN REBAJE DE BLOQUEO PARA SOSTENER LAS CORREDERAS. EL CUERPO Y LA TAPA TIENEN UNA LENGÜETA MOLDEADA PARA PERMITIR QUE SE CONECTEN ENTRE SÍ PARA SU TRANSPORTE. LAS MEDIDAS DE LA JARRA: 83 MM (ALTO) X 33 MM (ANCHO) X 3 MM (ALTO)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 210, "currency": "MXN" } } }, { "id": "0", "description": "JUEGO DE BARRAS MAGNETICAS (10 PZAS.)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2230, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO. VIDRIO. 2 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 330, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO. VIDRIO. 500 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 408, "currency": "MXN" } } }, { "id": "0", "description": "MICROJERINGA DE VIDRIO DE 10 MICROLITROS, GRADUACION DE 1 MICROLITRO, PUNTA BISELADA", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1100, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 300, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO GRADO 1", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 300, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO GRADO 3", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 500, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO PAPEL FILTRO 589/3 DE 12.5 CMS. CJ. C/100", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1015, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO PAPEL FILTRO NUM. 1 DE 12.5 CMS. CJ. C/100", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 300, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA DESECHABLE ESTÉRIL 10ML SUBDIVISIÓN O.5ML.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 872, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA DESECHABLE ESTÉRIL 5ML SUBDIVISIÓN O.5ML.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 880, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA SEROLOGICA DE POLIESTIRENO 5MLX0.01ML ESTERILES, LIBRE\nPIROGÉNOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1990, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS DE PLÁSTICO CON BULBO INCLUIDO DE 1 ML ESTÉRILES.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1220, "currency": "MXN" } } }, { "id": "0", "description": "PLACA DE CON 96 POZOS DE POLIESTIRENO, TRANSPARENTES. DESECHABLES, GRADO BIOMÉDICO. PARA ENSAYO TIPO ELISA.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1342, "currency": "MXN" } } }, { "id": "0", "description": "PLACAS DE CULTIVO ESTÉRILES DE 6 POZOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2609, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE CULTIVO CELULAR CON CÁMARA DE 8 POZOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 10700, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO. 250 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 220, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO. GRADUADA. 10 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 100, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS ESTERILES PARA PIPETA AUTOMATICA DE 10 MICROLITROS CAJA C/96 10 RACKS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 442.55, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS AMARILLAS 200 UL. NO ESTERILES. LIBRES DE RNASAS, DNASAS Y NO PIROGENICAS.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 163, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS DESECHABLES PARA PIPETAS AUTOMATICAS VOLUMEN VARIABLE 1000 A 5000 MICROLITROS BOLSA C/1000", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 890, "currency": "MXN" } } }, { "id": "0", "description": "RASTRILLOS DE CULTIVO (CELLTREAT CELL SCRAPER) DE 25 CENTÍMETROS DE LARGO DEL MANGO; ESTÉRILES.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1575, "currency": "MXN" } } }, { "id": "0", "description": "SISTEMA DE FILTRACIÓN DE 100 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1150, "currency": "MXN" } } }, { "id": "0", "description": "TAMIZ O SEPARADOR DE CÉLULAS, DE NYLON Y POLIPROPILENO; ESTÉRIL DE 40 MICRÓMETROS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1300, "currency": "MXN" } } }, { "id": "0", "description": "TUBO FILTRADOR,500ML,45MM,.22UM,ACETAT. VASO DE POLIESTIRENO CON MEMBRANA DE ACETATO DE CELULOSA (PORO DE 0.22 ¿M) PARA FILTRACIO´N AL VACIO´CAPACIDAD DE 500 ML, , CONEXIO´N PARA MANGUERA DE TOMA DE VACI´O.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1750, "currency": "MXN" } } }, { "id": "0", "description": "TUBO P/CENTRIFUGA 50ML DE POLIPROPILENO FONDO CONICO, TAPÓN DE ROSCA ESTÉRILES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2698, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS DE 1.5 ML ESTÉRILES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 201, "currency": "MXN" } } }, { "id": "0", "description": "UNIDAD DE FILTRACIÓN 500 ML ESTÉRIL 0.22 MICRAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1727, "currency": "MXN" } } }, { "id": "0", "description": "UNIDADES DE FILTRACIÒN FLUJO RAPIDO PES0.22MM, 45MM", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1394, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO 20 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 56, "currency": "MXN" } } }, { "id": "0", "description": "VASOS DE KOPLIN DE VIDRIO PARA 8 LAMINILLAS", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 650, "currency": "MXN" } } }, { "id": "0", "description": "CAJA DE POLIPROPILENO CON TAPA, CON CAPACIDAD PARA ALMACENAR 100 EPENDORFS DE 1.5-2.0 ML, 130 X130X50 MM.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 157, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA DE PLÁSTICO PARA 80 VIALES DE 1.5 Y 2.0 ML., MICROTUBOS, TUBOS DE 25*32 MM. PAQUETE CON 5 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 80, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA DE PLASTICO PARA 80 TUBOS TIPO CON TAPÓN PLANO 1.5 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 80, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ DEWARD DELABS04950", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 9045, "currency": "MXN" } } }, { "id": "0", "description": "MINIBOMBA OSMÓTICA (0.25µL/H)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 16906, "currency": "MXN" } } }, { "id": "0", "description": "MINIBOMBA OSMÓTICA (0.5µL/H)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 14375, "currency": "MXN" } } }, { "id": "0", "description": "ALBUMIN, BOVINE, FATTY ACID-FREE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5175, "currency": "MXN" } } }, { "id": "0", "description": "ALBUMINA SÉRICA BOVINA FRACCIÓN V, GRADO BIOLOGÍA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4900, "currency": "MXN" } } }, { "id": "0", "description": "SACAROSA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2400, "currency": "MXN" } } }, { "id": "0", "description": "SACAROSA GRADO ACS, 500 G", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1030, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE SODIO ACS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 245, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE SODIO CRISTALES GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 546, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE SODIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1435, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO FÉRRICO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1442, "currency": "MXN" } } }, { "id": "0", "description": "XYLENOL ORANGE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1368, "currency": "MXN" } } }, { "id": "0", "description": "ACETATO DE PLOMO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 686, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO DIBÁSICO DE POTASIO GRADO ACS FRASCO 500 GR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1107, "currency": "MXN" } } }, { "id": "0", "description": "AZUL DE ANILINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15020, "currency": "MXN" } } }, { "id": "0", "description": "AZUL DE BROMOFENOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1390, "currency": "MXN" } } }, { "id": "0", "description": "AZUL DE BROMOFENOL DE SODIO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 405, "currency": "MXN" } } }, { "id": "0", "description": "AZUL DE TIAZOLIL BROMURO DE TETRAZOLIO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1450, "currency": "MXN" } } }, { "id": "0", "description": "CRYSTAL VIOLET", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 282, "currency": "MXN" } } }, { "id": "0", "description": "EOSINA AMARILLENTA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 952, "currency": "MXN" } } }, { "id": "0", "description": "HEMATOXILINA DE HARRIS LISTA PARA USAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 902, "currency": "MXN" } } }, { "id": "0", "description": "2-PROPANOL, GRADO BIOLOGÍA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1100, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2780, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA CON PUREZA DE 99%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 900, "currency": "MXN" } } }, { "id": "0", "description": "ACETONITRILO GRADO HPLC , FRASCO 4 LT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1102, "currency": "MXN" } } }, { "id": "0", "description": "CLOROFORMO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1935, "currency": "MXN" } } }, { "id": "0", "description": "ETANOL GRADO BIOLOGÍA MOLECULAR 500ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 970, "currency": "MXN" } } }, { "id": "0", "description": "ISOPROPANOL GRADO HPLC", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2540, "currency": "MXN" } } }, { "id": "0", "description": "TETRAHIDROFURANO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3990, "currency": "MXN" } } }, { "id": "0", "description": "XILENO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 819, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA EN ENVASE DE PLÁSTICO.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 263, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO CLORHÍDRICO REACTIVO ANALÍTICO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 217, "currency": "MXN" } } }, { "id": "0", "description": "COLORANTE DE WRIGTH (MERK)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 476, "currency": "MXN" } } }, { "id": "0", "description": "CRIOVIAL DE POLIPROPILENO DE 2 ML BASE PLANA PARA CONGELACION, CON TAPAROSCA Y GRADUADO, ESTERILES Y LIBRES DE PIROGENOS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2499, "currency": "MXN" } } }, { "id": "0", "description": "FIB – TEM 10 X 5 (REACTIVO TRANSPARENTE PARA LA EVALUACIÓN DEL CONTENIDO DE FIBRINOGENO Y POLIMERIZACIÓN DE FIBRINA MEDIANTE TROMBOELASTOMETRÍA. COMPONENTES: CITOCALASINA D, CACL2 Y CONSERVANTES)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 100, "currency": "MXN" } } }, { "id": "0", "description": "HEMATOXILINA DE HARRIS LIBRE DE OXIDO DE MERCURIO ROJO, LISTA PARA USARSE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 902, "currency": "MXN" } } }, { "id": "0", "description": "HIDRÓXIDO DE SODIO REACTIVO ANALÍTICO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 345, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 100 PB EN ESCALERA DE 100 PB", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2177, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR DE DNA DE 50 PB EN ESCALERA DE 50 PB", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2775, "currency": "MXN" } } }, { "id": "0", "description": "METANOL GRADO HPLC", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 500, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE PLATA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15700, "currency": "MXN" } } }, { "id": "0", "description": "ROJO NUCLEAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 28000, "currency": "MXN" } } }, { "id": "0", "description": "BULBO DE SUCCION DE GOMA PARA PIPETA DE VIDRIO", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 120, "currency": "MXN" } } }, { "id": "0", "description": "CAJA DE PLASTICO PARA 25 LAMINILLAS COLOR NEGRO PARA PORTA OBJETOS DE MEDIDA ESTANDAR 75 X 25 MM", "classification": { "scheme": "CUCOP", "id": "25501-0101", "description": "CAJAS PLASTIFICADAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "DENSIMETRO CON PROBETA DE CRISTAL", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 500, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA PARA TUBO DE WINTROBE CON NIVEL DE BURBUJA Y TORNILLOS PARA AJUSTE DE NIVEL", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 5790, "currency": "MXN" } } }, { "id": "0", "description": "MORTERO CON MANO GRANDE DEPORCELANA 400 ML", "classification": { "scheme": "CUCOP", "id": "25501-0027", "description": "MORTERO DE LABORATORIO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 255, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL FILTRO WHATMAN NO. 1 CIRCULAR DE 185 MM DE DIÁMETRO CAJA C/100", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 620, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS AUTOMATICAS DE VOLUMEN VARIABLE DE 10 A 1000 µL", "classification": { "scheme": "CUCOP", "id": "25501-0026", "description": "MICROPIPETAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1040, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS AUTOMATICAS VOLUMEN VARIABLE 10 A 200 µL", "classification": { "scheme": "CUCOP", "id": "25501-0026", "description": "MICROPIPETAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1050, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS PASTEUR DE PLASTICO DE 1.5 ML REF. 200003.C", "classification": { "scheme": "CUCOP", "id": "25501-0031", "description": "PIPETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 525, "currency": "MXN" } } }, { "id": "0", "description": "PROBETAS DE PLASTICO 500ML", "classification": { "scheme": "CUCOP", "id": "25501-0037", "description": "PROBETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 230, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA DE 10 A 100 µL (AMARILLAS)", "classification": { "scheme": "CUCOP", "id": "25501-0095", "description": "PUNTAS PARA MICROPIPETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 163, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE ENSAYO DE VIDRIO FONDO EN U DE 10 X 75 MM SIN LABIO, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM", "classification": { "scheme": "CUCOP", "id": "25501-0047", "description": "TUBO ENSAYO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 155, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE ENSAYO DE VIDRIO FONDO EN U DE 12 X 75 MM SIN LABIO, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM", "classification": { "scheme": "CUCOP", "id": "25501-0047", "description": "TUBO ENSAYO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 165, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS CORTE DIAMANTADO DE TAMAÑO 25X75 MM Y 0.8-1.1 MM GROSOR, BORDES PULIDOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 35, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS DE 1 A 1.2MM DE ESPESOR CON BORDES ESMERILADOS Y BANDA MATE PARA ETIQUETAR. TAMAÑO 25X75MM", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 48, "currency": "MXN" } } }, { "id": "0", "description": "LECHE DESCREMADA EN POLVO BASE PARA USO EN MEDIO DE CULTIVO MICROBIOLÓGICO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1964.21, "currency": "MXN" } } }, { "id": "0", "description": "DILUYENTE PARA INMUNOHISTOQUIMICA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1150, "currency": "MXN" } } }, { "id": "0", "description": "AGAR MAC CONKEY MEDIO DE CULTIVO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1112.5, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-HORMONA DE CRECIMIENTO (GH) PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8330, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-RECEPTOR DE ESTROGENOS PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15998, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD34 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 13592, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO VIMENTINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10495.28, "currency": "MXN" } } }, { "id": "0", "description": "CUCHILLAS DESECHABLES DE BAJO PERFIL PARA MICROTÓMO, MEDIDAS DE 80 X 8 X 0.25 MM", "classification": { "scheme": "CUCOP", "id": "25501-0106", "description": "CUCHILLAS PARA MICROTOMO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2500, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS ELECTROCARGADOS DE 75MM X 25MM", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 38, "currency": "MXN" } } }, { "id": "0", "description": "ALEXA FLUOR 647 ANTI-HUMAN CD41", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8899, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI RATÓN F4/80 PE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3885, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUEPO ANTI-NEUN (FOXO3)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10411, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-HIF-2 ALFA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8436, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL ANTI-RABBIT IGG, PRODUCIDO EN RATÓN.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2738, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PROHIBITIN 2 ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11944, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PURIFICADO ANTI-TUBULIN ¿3 (TUBB3)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4381, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-GAPDH ANTIBODY, MOUSE MONOCLONAL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5017, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-HUMAN IGG PRODUCED IN GOAT .", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6190, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-KATI (HUMAN, MOUSE, RAT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11173, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-KMO (HUMAN, MOUSE)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15570, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-KYAT3 (HUMAN, MOUSE, RAT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 13905, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-NR4A2 (N-TERMINAL) ANTIBODY PRODUCED IN RABBIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14450, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-NRF2 ANTIBODY PRODUCED IN RABBIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11173, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-RABBIT IGG, HRP-LINKED ANTIBODY, 100 UL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4155, "currency": "MXN" } } }, { "id": "0", "description": "APC/CYANINE7 ANTI-HUMAN CD4 ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3472, "currency": "MXN" } } }, { "id": "0", "description": "APC/CYANINE7 ANTI-MOUSE CD3 ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2893, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO BETA TUBULIN 3/ TUJ1", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 13638, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI HUMAN CD63 BRILLIANT VIOLET 711", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12288, "currency": "MXN" } } }, { "id": "0", "description": "BV605 ANTI-MOUSE CD185 125UL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6227, "currency": "MXN" } } }, { "id": "0", "description": "CDKN1B/P27KIP1 RABBIT PAB", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4285, "currency": "MXN" } } }, { "id": "0", "description": "CX3CR1 ANTIBODY (HUMAN, MOUSE, RAT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4798, "currency": "MXN" } } }, { "id": "0", "description": "GCLM RABBIT PAB (HUMAN, MOUSE, RAT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8815, "currency": "MXN" } } }, { "id": "0", "description": "HORSE ANTI-MOUSE IGG ANTIBODY (H+L), PEROXIDASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6172, "currency": "MXN" } } }, { "id": "0", "description": "KMO ANTIBODY N-TERMINAL REGION (HUMAN, MOUSE, RAT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11678, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO LAMP2 (D5C2P) RABBIT MAB", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10669, "currency": "MXN" } } }, { "id": "0", "description": "HUMAN NEUROINFLAMMATION PANEL 1 (13-PLEX)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 48516, "currency": "MXN" } } }, { "id": "0", "description": "GUANOSINE 5'-TRIPHOSPHATE SODIUM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 19860, "currency": "MXN" } } }, { "id": "0", "description": "SONIC HEDGEHOG RECOMBINANTE HUMANO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10133, "currency": "MXN" } } }, { "id": "0", "description": "DMEM/F-12, POWDER, HIGH GLUCOSE, 10 X 1 L", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2570, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO KNOCKOUT(TM) D-MEM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1583, "currency": "MXN" } } }, { "id": "0", "description": "FLUO-4 PENTAPOTASSIUM SALT, CELL IMPERMEANT (500 ¿G)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7221, "currency": "MXN" } } }, { "id": "0", "description": "HISTOPAQUE-1077", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5550, "currency": "MXN" } } }, { "id": "0", "description": "LINEA CELULAR DE GLIOBLASTOMA U87- MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 21984, "currency": "MXN" } } }, { "id": "0", "description": "DYEEX 2.0 SPIN (250)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 29103, "currency": "MXN" } } }, { "id": "0", "description": "EPIQUIK TISSUE CHROMATIN IMMUNOPRECIPITATION (CHIP) KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 13377, "currency": "MXN" } } }, { "id": "0", "description": "HISTONE DEACETYLASE (HDAC) ANTIBODY SAMPLER KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 16624, "currency": "MXN" } } }, { "id": "0", "description": "HUMAN TH1/TH2/TH17 CYTOKINE KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 33716, "currency": "MXN" } } }, { "id": "0", "description": "IN SITU CELL DEATH DETECTION KIT, FLUORESCEIN.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 16662, "currency": "MXN" } } }, { "id": "0", "description": "OPTI-4CN SUBSTRATE KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7065, "currency": "MXN" } } }, { "id": "0", "description": "QUINOLINIC ACID ELISA KIT:96 WELLS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 20872, "currency": "MXN" } } }, { "id": "0", "description": "SENESCENCE ¿-GALACTOSIDASE STAINING KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8763, "currency": "MXN" } } }, { "id": "0", "description": "MP TETRA 4GEL/STAIN-FREE FASTC", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 33393, "currency": "MXN" } } }, { "id": "0", "description": "STREPTAVIDIN MAGNETIC BEADS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 31761, "currency": "MXN" } } }, { "id": "0", "description": "N,N-DIISOPROPYLETHYLAMINE (DIPEA)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2805, "currency": "MXN" } } }, { "id": "0", "description": "5-HYDROXYTRYPTAMINE CLORHIDRATO(SEROTONINA)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3261, "currency": "MXN" } } }, { "id": "0", "description": "AGE MODIFIED BSA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9894, "currency": "MXN" } } }, { "id": "0", "description": "AM251 (CB1 CANNABINOID RECEPTOR ANTAGONIST)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4741, "currency": "MXN" } } }, { "id": "0", "description": "ARACHIDONYL-2'-CHLOROETHYLAMIDE HYDRATE (ACEA)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5819, "currency": "MXN" } } }, { "id": "0", "description": "BIOCYTIN 98% (TLC)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3152, "currency": "MXN" } } }, { "id": "0", "description": "BLOTTING-GRADE BLOCKER. 300 G, NONFAT DRY MILK FOR WESTERN BLOTTING APPLICATIONS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2082, "currency": "MXN" } } }, { "id": "0", "description": "CACODILATO DE SODIO, TRIHIDRATADO,", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 28627, "currency": "MXN" } } }, { "id": "0", "description": "CHIR 99021", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5632, "currency": "MXN" } } }, { "id": "0", "description": "TIRAS DE 8 TUBOS DE .2 ML PARA PCR", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 850, "currency": "MXN" } } }, { "id": "0", "description": "ACRÍLICO DENTAL AUTOCURABLE NO. 66 C", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 250, "currency": "MXN" } } }, { "id": "0", "description": "MONÓMERO PARA ACRÍLICO DENTAL AUTOCURABLE", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 540, "currency": "MXN" } } }, { "id": "0", "description": "(BOTELLA AUTOCLAVABLE LIBRE DE PIROGENOS DE 100 ML)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 100, "currency": "MXN" } } }, { "id": "0", "description": "(BOTELLA AUTOCLAVABLE LIBRE DE PIROGENOS DE 250 ML)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 120, "currency": "MXN" } } }, { "id": "0", "description": "10 µL, MODEL 701 CEMENTED NEEDLE SPECIAL (SN) SYRINGE", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3200, "currency": "MXN" } } }, { "id": "0", "description": "ANILLOS PARA INCLUSIÓN DE TEJIDOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "APLICADORES DE MADERA, 6\"X 1/12\"", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 215, "currency": "MXN" } } }, { "id": "0", "description": "APLICADORES DE PLÁSTICO 15 CM CON ALGODÓN; PAQUETES CON 3 PIEZAS.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 380, "currency": "MXN" } } }, { "id": "0", "description": "BENZAL", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 120, "currency": "MXN" } } }, { "id": "0", "description": "CAJA DE POLIPROPILENO, CON CAPACIDAD PARA ALMACENAR 100 EPENDORFS DE 1.5-2.0 ML, 130 X130X50 MM.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 160, "currency": "MXN" } } }, { "id": "0", "description": "CAJA PETRI DESECHABLE, PARA CULTIVO CELULAR DE POLIESTIRENO, ESTÉRIL; TAMAÑO DE 35X10 MILÍMETROS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 5800, "currency": "MXN" } } }, { "id": "0", "description": "CANULA DE POLIETILENO (PE10), DIÁMETRO INTERNO 0.28MM , DIÁMETRO EXTERNO .61MM. ROLLO DE 100 PIES (FT)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 12000, "currency": "MXN" } } }, { "id": "0", "description": "CILINDRO DE METAL PARA GUARDAR Y ESTERILIZAR PIPETA PASTEUR, DE 20 CM LARGO X 20 CM DE DIÁMETRO.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 800, "currency": "MXN" } } }, { "id": "0", "description": "CRONOMETRO 3 CANALES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 650, "currency": "MXN" } } }, { "id": "0", "description": "CUBREOBJETOS DE VIDRIO CIRCULAR 12MM.", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1500, "currency": "MXN" } } }, { "id": "0", "description": "CUVETTES DE CUARZO PARA ESPECTROFOTÓMETRO, 45MM ALTURA, 3.5ML DE CAPACIDAD.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1600, "currency": "MXN" } } }, { "id": "0", "description": "FILTROS DE NYLON PIRINOLA, 0.22 UM", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "FILTROS DE NYLON PIRINOLA, 0.45 UM", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2600, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA PARA 96 MICROTUBOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "HOJA DE BISTURÍ NUM. 15", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 400, "currency": "MXN" } } }, { "id": "0", "description": "HOJA DE BISTURÍ NUM. 20", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 400, "currency": "MXN" } } }, { "id": "0", "description": "LÁPIZ PUNTA DIAMANTE", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 500, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR PARA PORTAOBJETOS, \"PAP-PEN\", NORMAL", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1800, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO. VIDRIO. 1000 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 580, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO. VIDRIO. 25 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ VOLUMÉTRICO “A”. VIDRIO. TAPÓN. 10 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 300, "currency": "MXN" } } }, { "id": "0", "description": "MECHERO", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 250, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANA DE DIÁLISIS SPECTRA/POR 3. MWCO 3.5 KDA DE 34 MILÍMETROS DE DIÁMETRO, 54 MILÍMETROS DE ANCHO Y 50 PIES DE LARGO DAIGGER X6026 ROLLO DE 50 PIES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 10800, "currency": "MXN" } } }, { "id": "0", "description": "MICROPIPETA DIGITAL DE 12 CANALES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 8200, "currency": "MXN" } } }, { "id": "0", "description": "NAVAJA PARA BISTURI NO.20 ACERO INOXIDABLE", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 500, "currency": "MXN" } } }, { "id": "0", "description": "NAVAJAS DE AFEITAR DOBLE FILO, C/", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 50, "currency": "MXN" } } }, { "id": "0", "description": "NAVAJAS DE UN SOLO FILO. CAJA C/100 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 450, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL ALUMINIO, ROLLO DE 30.5 CM X 304.8 M", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 950, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL PARAFILM 10 CM X 7.6 M (4PULGADAS X 125 PIES)", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 780, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL PH DE 0.0 A 14.0 CJ. C/100", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "PELÍCULA ADHESIVA ÓPTICA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3000, "currency": "MXN" } } }, { "id": "0", "description": "PINZA C/PUNTA FINA Y ASERRADA, DE ACER, INOX", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 400, "currency": "MXN" } } }, { "id": "0", "description": "PINZA EMS DE 110MM CON PUNTA DOBLADA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO. GRADUADA. 25 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 190, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS DE 200 µL EN RACK.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 850, "currency": "MXN" } } }, { "id": "0", "description": "RACK DE POLIPROPILENO CON CAPACIDAD PARA 96 TUBO EPENDORF DE 1.5- 2.0 ML, DE UNA CARA Y DE LA PARTE INFERIOR PARA 96 TUBO DE .5 A 1.0 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "REJILLAS DE COBRE 200 MESH PARA MICROSCOPÍA ELECTRÓNICA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 900, "currency": "MXN" } } }, { "id": "0", "description": "REJILLAS DE NIQUEL 200 MESH PARA MICROSCOPÍA ELECTRÓNICA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "ROLLO DE MANGUERA TUBO HOLY LATEX2040. DIAMETRO INTERIOR 6.2MM, EXTERIOR 10.6 MM, ESPESOR 2.2MM. 15 M", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 750, "currency": "MXN" } } }, { "id": "0", "description": "SPECTROFOTOMETER QUARTZ CELLS 3.5 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2600, "currency": "MXN" } } }, { "id": "0", "description": "TELA QUIRÚRGICA ADHESIVA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 78, "currency": "MXN" } } }, { "id": "0", "description": "TUBO TIPO EPPENDORF CON TAPA COLOR AMBAR. BOLSA C/1000 PZAS. 1.5 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1200, "currency": "MXN" } } }, { "id": "0", "description": "TUBO PARA MICROCENTRIFUGA TRANSPARENTE DE 2.0 ML. BOLSA C/1000 PZAS (TIPO EPENDORF) AMBAR", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1500, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE POLIPROPILENO DE 250 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 50, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 100 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 45, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO DE VIDRIO TEMPLADO DE 250 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 60, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADODE VIDRIO TEMPLADO DE 50 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 45, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADOS DE 10 ML DE VIDRIO TEMPLADO", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 25, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADOS DE 500 ML DE VIDRIO TEMPLADO", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 98, "currency": "MXN" } } }, { "id": "0", "description": "VASO PRECIPITADO DE VIDRIO TEMPLADO DE 1000ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 150, "currency": "MXN" } } }, { "id": "0", "description": "VASO PRECIPITADO DE VIDRIO TEMPLADO DE 2000ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS DE PCR CON TAPÓN PLANO 1.5 ML TRANSPARENTES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 650, "currency": "MXN" } } }, { "id": "0", "description": "CONTADOR DE CÉLULAS SANGUÍNEAS DE 5 LLAVES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 6900, "currency": "MXN" } } }, { "id": "0", "description": "CRONÓMETRO DE 3 CANALES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 600, "currency": "MXN" } } }, { "id": "0", "description": "EMBUDO DE POLIPROPILENO DE 10 CM DIÁMETRO", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 75, "currency": "MXN" } } }, { "id": "0", "description": "EMBUDO DE POLIPROPILENO DE 15 CM DIÁMETRO", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 90, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA DE 0.5 µL A 20 µL", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 180, "currency": "MXN" } } }, { "id": "0", "description": "TEMPORIZADOR DIGITAL CUENTA TRIPLE DE ABAJO/ARRIBA, PANTALLA LCD GRANDE", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1000, "currency": "MXN" } } }, { "id": "0", "description": "VIAL DE VIDRIO CON TAPA DE ROSCA PARA CENTELLEO DE 20 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1000, "currency": "MXN" } } }, { "id": "0", "description": "ACRILICO DENTAL AUTOPOLIMERIZABLE TRANSPARENTE. SECADO RAPIDO. POLVO.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1800, "currency": "MXN" } } }, { "id": "0", "description": "ACRILICO DENTAL AUTOPOLIMERIZABLE. SECADO RAPIDO. LIQUIDO. FCO. 100 GRS.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "ACRILICO DENTAL AUTOPOLIMERIZABLE. SECADO RAPIDO. POLVO. FCO. 100 GRS.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 650, "currency": "MXN" } } }, { "id": "0", "description": "MEDIO DE INCLUSIÓN PARA TEJIDO EN FRESCO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 380, "currency": "MXN" } } }, { "id": "0", "description": "RESINA LR WHITE GRADO MEDIO, PARA MICROSCOPIA ELECTRONICA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10000, "currency": "MXN" } } }, { "id": "0", "description": "TISSUE TECK", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 380, "currency": "MXN" } } }, { "id": "0", "description": "PAP PEN TED PELLA FOR IMMUNOSTAINING 2MM.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1800, "currency": "MXN" } } }, { "id": "0", "description": "SOLVENTE PARA ACRILICO DENTAL AUTOPOLIMERIZABLE. SECADO RAPIDO. LIQUIDO.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-ACTH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1600, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR PAP PEN (PLUMA) PARA INMUNOHISTOQUÍMICA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1800, "currency": "MXN" } } }, { "id": "0", "description": "AGITADORES DE VIDRIO 6.4MM", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 43, "currency": "MXN" } } }, { "id": "0", "description": "APLICADORES DE MADERA CON PUNTA DE ALGODÓN", "classification": { "scheme": "CUCOP", "id": "25501-0091", "description": "MATERIAL DE MADERA PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 500, "currency": "MXN" } } }, { "id": "0", "description": "BASES PLASTICAS PARA LAS AGUJAS DE TOMA DE MUESTRA SANGUINEA AL VACIO (DE LA MISMA MARCA DE LAS AGUJAS)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 50, "currency": "MXN" } } }, { "id": "0", "description": "BOLSA DE PLASTICO CON CIERRE HERMETICO DENTADO (DOBLE SIERRE) TAMAÑO 18 CM X 20 CM TIPO ZIPLOC CAJA C/25 BOLSAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 160, "currency": "MXN" } } }, { "id": "0", "description": "BOLSA DE PLASTICO CON CIERRE HERMETICO DENTADO (DOBLE SIERRE) TAMAÑO 27 CM X 28 CM TIPO ZIPLOC CAJA CON 25 BOLSAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 220, "currency": "MXN" } } }, { "id": "0", "description": "BOLSAS DE PIPETAS DE TRANSFERENCIA DE 2 ML C/100", "classification": { "scheme": "CUCOP", "id": "25501-0031", "description": "PIPETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 180, "currency": "MXN" } } }, { "id": "0", "description": "BULBOS PARA PIPETA PASTEUR PARA 2 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 10, "currency": "MXN" } } }, { "id": "0", "description": "CAJA DE PETRI DESECHABLE ESTÉRIL DE 90 X 150 MM (MUESTRA FÍSICA)", "classification": { "scheme": "CUCOP", "id": "25501-0005", "description": "CAJA PETRI" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1500, "currency": "MXN" } } }, { "id": "0", "description": "CAJA RELLENABLE DE PUNTAS PARA PIPETA AUTOMATICA (TIPBOX-TIPRACK) DE 100µL", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 70, "currency": "MXN" } } }, { "id": "0", "description": "CAJA RELLENABLE DE PUNTAS PARA PIPETA AUTOMATICA (TIPBOX-TIPRACK) DE 1000µL", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 90, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS PARA ALMACENAR MICROTUBOS Y CRIOTUBOS (CRIOVIALES) DE 2ML DE BASE PLANA PARA CONGELACIÓN", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 150, "currency": "MXN" } } }, { "id": "0", "description": "CHAIRA DE 30 CM DE LARGO", "classification": { "scheme": "CUCOP", "id": "25501-0092", "description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 90, "currency": "MXN" } } }, { "id": "0", "description": "CUBRE HEMACIÍMETRO/CUBRE OBJETOS 22 X 22 MM", "classification": { "scheme": "CUCOP", "id": "25501-0109", "description": "CUBREHEMATIMETRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 28, "currency": "MXN" } } }, { "id": "0", "description": "CUCHILLAS DESECHABLES DE ALTO PERFIL PARA MICROTÓMO, MEDIDAS DE 80 X 14 X 0.35 MM", "classification": { "scheme": "CUCOP", "id": "25501-0106", "description": "CUCHILLAS PARA MICROTOMO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 4100, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODO PARA IONES ESPECIFICOS (ELECTRODO PARA NEUROESTIMILADOR DE 5CM X 5CM, CUADRADO, MODELO CF5050 COMPATIBLE CON EQUIPO VALU TRODE PROPIEDAD DEL INNN PAQUETE CON 4 PIEZAS)", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 270, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON DE DE 60 CM DE LARGO CON CERDAS DE 18 CM X 5 CM DIÁMETRO", "classification": { "scheme": "CUCOP", "id": "25501-0097", "description": "ESCOBILLON PARA LABORATORIO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 90, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 10 X 75 MM", "classification": { "scheme": "CUCOP", "id": "25501-0097", "description": "ESCOBILLON PARA LABORATORIO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 18, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 12 X 100 MM", "classification": { "scheme": "CUCOP", "id": "25501-0097", "description": "ESCOBILLON PARA LABORATORIO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 18, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLON PARA TUBO DE VIDRIO DE 12 X 75 MM", "classification": { "scheme": "CUCOP", "id": "25501-0097", "description": "ESCOBILLON PARA LABORATORIO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 18, "currency": "MXN" } } }, { "id": "0", "description": "ESCOBILLONES PARA PROBETAS DE 2000 ML", "classification": { "scheme": "CUCOP", "id": "25501-0097", "description": "ESCOBILLON PARA LABORATORIO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 66, "currency": "MXN" } } }, { "id": "0", "description": "ESTUCHE DE CARTON PLEGABLE PARA 1 LAMINILLA DE 1 X 3 PULGADAS, DE 4 X 9.5 CM Y 0.5 CM DE GROSOR UNA VEZ CERRADA", "classification": { "scheme": "CUCOP", "id": "25501-0101", "description": "CAJAS PLASTIFICADAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 22, "currency": "MXN" } } }, { "id": "0", "description": "FILTROS 2097 P100 PARA 3M RESPIRADOR 6200", "classification": { "scheme": "CUCOP", "id": "25501-0082", "description": "FILTROS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2500, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE PLASTICO CON TAPA DE ROSCA (PARA MUESTRAS DE ORINA), NO ESTERIL", "classification": { "scheme": "CUCOP", "id": "25501-0018", "description": "FRASCO AMBAR" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3.5, "currency": "MXN" } } }, { "id": "0", "description": "FRASCOS DE VIDRIO ÁMBAR TIPO JARABE DE 100 ML CON TAPÓN DE ROSCA", "classification": { "scheme": "CUCOP", "id": "25501-0018", "description": "FRASCO AMBAR" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 18, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLA MULTI-TUBOS. UNA CARA PARA 32 MICROTUBOS 0.5 ML, OTRA PARA MICROTUBOS 1.5 ML, OTRA PARA 12 TUBOS CÓNICOS 15 ML Y UNA PARA 4 TUBOS CÓNICOS 50 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "GRADILLAS DE PLASTICO DE 25 CM. DE LARGO X 10.5 CM. DE ANCHO X 5.5 CM. DE ALTO, PARA 90 TUBOS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 160, "currency": "MXN" } } }, { "id": "0", "description": "GUANTES DE HULE LATEX ROJOS TALLA MEDIANA N°8", "classification": { "scheme": "CUCOP", "id": "25501-0033", "description": "PORTA DELANTALES Y GUANTES" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 400, "currency": "MXN" } } }, { "id": "0", "description": "LÁPICES CON PUNTA DIAMANTE PARA ROTULAR PORTAOBJETOS RETRACTILES", "classification": { "scheme": "CUCOP", "id": "25501-0104", "description": "LAPIZ PUNTA DIAMANTE" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 500, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ AFORADO 1000 ML, VIDRIO", "classification": { "scheme": "CUCOP", "id": "25501-0024", "description": "MATRAZ" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 550, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ ERLENMEYER DE 2 LT", "classification": { "scheme": "CUCOP", "id": "25501-0024", "description": "MATRAZ" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 300, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL PARAFILM 10.16 CM X 38 MTS", "classification": { "scheme": "CUCOP", "id": "25501-0103", "description": "PAPEL PARAFILM" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 750, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL SEDA PARA LIMPIAR OBJETIVOS DE MICROSCOPIO DE 4 X 6 PULGADAS", "classification": { "scheme": "CUCOP", "id": "25501-0103", "description": "PAPEL PARAFILM" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 70, "currency": "MXN" } } }, { "id": "0", "description": "PIEZA FACIAL DE MEDIA CARA 3M MODELO 6100/07024 PARA FILTRO 3M MOD. 07024 PROPIEDAD DEL INNN", "classification": { "scheme": "CUCOP", "id": "25501-0082", "description": "FILTROS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 680, "currency": "MXN" } } }, { "id": "0", "description": "PINZA BAYONETA CHICA PARA ORL", "classification": { "scheme": "CUCOP", "id": "25501-0080", "description": "PINZAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "PINZA BAYONETA GRANDE PARA ORL", "classification": { "scheme": "CUCOP", "id": "25501-0080", "description": "PINZAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 280, "currency": "MXN" } } }, { "id": "0", "description": "PINZA CAIMÁN DE OIDO", "classification": { "scheme": "CUCOP", "id": "25501-0080", "description": "PINZAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3000, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS CON PUNTA GRUESA CON SIERRA DE 15 CM DE LARGO", "classification": { "scheme": "CUCOP", "id": "25501-0080", "description": "PINZAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 220, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS CURVAS FINAS DE 15 CM DE LARGO", "classification": { "scheme": "CUCOP", "id": "25501-0080", "description": "PINZAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 800, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS CURVAS GRUESAS DE 15 CM DE LARGO", "classification": { "scheme": "CUCOP", "id": "25501-0080", "description": "PINZAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 400, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS DE DISECCION SIN DIENTES DE 20 CM DE LARGO", "classification": { "scheme": "CUCOP", "id": "25501-0080", "description": "PINZAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 100, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS DE PUNTA FINA CON SIERRA DE 15 CM DE LARGO", "classification": { "scheme": "CUCOP", "id": "25501-0080", "description": "PINZAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1000, "currency": "MXN" } } }, { "id": "0", "description": "PINZAS KELLY", "classification": { "scheme": "CUCOP", "id": "25501-0080", "description": "PINZAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 250, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS PASTEUR DE VIDRIO DE 145 MM DE LARGO", "classification": { "scheme": "CUCOP", "id": "25501-0031", "description": "PIPETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 250, "currency": "MXN" } } }, { "id": "0", "description": "PISETA DE PLÁSTICO DE 1000 ML", "classification": { "scheme": "CUCOP", "id": "25501-0068", "description": "PISETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 150, "currency": "MXN" } } }, { "id": "0", "description": "PISETA DE PLÁSTICO DE 500 ML", "classification": { "scheme": "CUCOP", "id": "25501-0068", "description": "PISETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 140, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS CON PANTALLA ESMERILADA DE 75 MM X 25 MM", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 45, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS PARA MICROCOSPIA, 25 X 75 MM CON BORDES PULIDOS SIN ESMERILADO (MUESTRA FISICA)", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 35, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS PARA MICROSCOPIA DE 25 X 75 MM, BORDES LISOS SIN ESMERILADO.", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 30, "currency": "MXN" } } }, { "id": "0", "description": "PORTAOBJETOS PARA MICROSCOPIA, 25 X 75 MM, CON BORDES PULIDOS SIN ESMERILADO (MUESTRA FÍSICA) CAJA CON 50 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0035", "description": "PORTA OBJETOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 45, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO 1000 ML", "classification": { "scheme": "CUCOP", "id": "25501-0037", "description": "PROBETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 700, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO 250 ML", "classification": { "scheme": "CUCOP", "id": "25501-0037", "description": "PROBETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 350, "currency": "MXN" } } }, { "id": "0", "description": "PROBETAS DE PLASTICO 1000ML", "classification": { "scheme": "CUCOP", "id": "25501-0037", "description": "PROBETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 350, "currency": "MXN" } } }, { "id": "0", "description": "PROBETAS DE PLASTICO 2000ML", "classification": { "scheme": "CUCOP", "id": "25501-0037", "description": "PROBETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 650, "currency": "MXN" } } }, { "id": "0", "description": "SOPORTE DE CARRUSEL GIRATORIO PARA PIPETAS AUTOMATICAS 6 PLAZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 4100, "currency": "MXN" } } }, { "id": "0", "description": "25501-0096 DE VARILLA PARA LABORATORIO CON RANGO DE TEMPERATURA DE -10°C A 150°C", "classification": { "scheme": "CUCOP", "id": "25501-0096", "description": "TERMOMETRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 175, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE ENSAYO VIDRIO SIN LABIO FONDO EN U, 13 X 100 MM, DE BOROSILICATO, CENTRIFUGABLES DE 2500 A 3000 O MAS RPM, GROSOR DE LA PARED MINIMO DE 0.8 MM", "classification": { "scheme": "CUCOP", "id": "25501-0047", "description": "TUBO ENSAYO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 230, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE POLIESTIRENO DE 5 ML TRANSPARENTE DE (13 X 75 MM) CON TAPON BOLSA C/1000", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2200, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO VIDRIO DE 100 ML", "classification": { "scheme": "CUCOP", "id": "25501-0052", "description": "VASO PRECIPITADO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 48, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO VIDRIO DE 250 ML", "classification": { "scheme": "CUCOP", "id": "25501-0052", "description": "VASO PRECIPITADO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 60, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADO. VIDRIO. 1000 ML", "classification": { "scheme": "CUCOP", "id": "25501-0052", "description": "VASO PRECIPITADO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 150, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADOS DE 10 ML DE VIDRIO", "classification": { "scheme": "CUCOP", "id": "25501-0052", "description": "VASO PRECIPITADO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 36, "currency": "MXN" } } }, { "id": "0", "description": "VASO DE PRECIPITADOS DE 500 ML DE VIDRIO", "classification": { "scheme": "CUCOP", "id": "25501-0052", "description": "VASO PRECIPITADO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 110, "currency": "MXN" } } }, { "id": "0", "description": "AHR ANTIBODY [RPT1]", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7832, "currency": "MXN" } } }, { "id": "0", "description": "ANTI CUERPO ANTI-A2B5", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10711, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-ERK1 (PT202/PY204) + ERK2 (PT185/PY187) ANTIBODY [EP197Y] (AB76299)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12293, "currency": "MXN" } } }, { "id": "0", "description": "ANTI-ERK1 + ERK2 ANTIBODY [EPR17526]", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 16675, "currency": "MXN" } } }, { "id": "0", "description": "APC/CYANINE7 MOUSE IGG2B, ¿ ISOTYPE CTRL ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8250, "currency": "MXN" } } }, { "id": "0", "description": "LAMIN B1 RABBIT MAB - NUCLEAR LOADING CONTROL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 16310, "currency": "MXN" } } }, { "id": "0", "description": "RHODAMINE (TRITC)–CONJUGATED GOAT ANTI-RABBIT IGG(H+L)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6207, "currency": "MXN" } } }, { "id": "0", "description": "SARS/SARS-COV-2 SPIKE PROTEIN S2 MONOCLONAL ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14728, "currency": "MXN" } } }, { "id": "0", "description": "SARS-COV-2 SPIKE PROTEIN S1 MONOCLONAL ANTIBODY (HL6)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 22031, "currency": "MXN" } } }, { "id": "0", "description": "TREM2 POLYCLONAL ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12537, "currency": "MXN" } } }, { "id": "0", "description": "VDAC1 RABBIT MAB - MITOCHONDRIAL LOADING CONTROL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 13024, "currency": "MXN" } } }, { "id": "0", "description": "ADN POLIMERASA PLATINUM TAQ", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2233, "currency": "MXN" } } }, { "id": "0", "description": "AGAROSA GRADO BIOLOGIA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4400, "currency": "MXN" } } }, { "id": "0", "description": "AMPLITAQ GOLD 360 MASTER MIX", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6266, "currency": "MXN" } } }, { "id": "0", "description": "BIS ACRILAMIDA GRADO BIOLOGIA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1900, "currency": "MXN" } } }, { "id": "0", "description": "DNA CLEAN & CONCENTRATOR-5 (50 PREPS) W / ZYMO-SPIN IC COLUMNS (CAPPED)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1150, "currency": "MXN" } } }, { "id": "0", "description": "DNASA I GRADO BIOLOGÍA MOLECULAR 50MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1316, "currency": "MXN" } } }, { "id": "0", "description": "DNASE I (RNASE-FREE)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1316, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN ECORI HF", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 200, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN HINFI", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 675, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN MBO I", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 383, "currency": "MXN" } } }, { "id": "0", "description": "ESCALERAS DE PROTEÍNAS PRETEÑIDAS 10 A 25 KDA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1491, "currency": "MXN" } } }, { "id": "0", "description": "ESTÁNDAR DE PESO MOLECULAR DUAL PARA PROTEÍNAS DE 2 A 250,000 DALTONES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1575, "currency": "MXN" } } }, { "id": "0", "description": "EXONUCLEASE I (E. COLI)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 541, "currency": "MXN" } } }, { "id": "0", "description": "GEL LOADING SOLUTION TYPE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 291, "currency": "MXN" } } }, { "id": "0", "description": "GEL RED NUCELIC ACID", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 783, "currency": "MXN" } } }, { "id": "0", "description": "11-250 KDA PRESTAINED PROTEIN LADDER", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1491, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR PARA PROTEÍNAS DE 10-250KDA, 500µL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1491, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PESO MOLECULAR; 10-250KDA WIDE RANGE BLUE/RED TW O COLOR,", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1491, "currency": "MXN" } } }, { "id": "0", "description": "MARCADORES DE PESO MOLECULAR DE PROTEÍNAS.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4991, "currency": "MXN" } } }, { "id": "0", "description": "MAXIMA SYBR GREEN/ROX QPCR MASTER MIX 2X. MASTER MIX 200 REACTIONS. CAT K0221", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2200, "currency": "MXN" } } }, { "id": "0", "description": "HRM MASTER MIX", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5400, "currency": "MXN" } } }, { "id": "0", "description": "MEZCLA MAESTRA UNIVERSAL DE PCR TAQMAN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9166, "currency": "MXN" } } }, { "id": "0", "description": "NEBUILDER HIFI DNA ASSEMBLY MASTER MIX", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4750, "currency": "MXN" } } }, { "id": "0", "description": "OLIGO (DT)12-18 PARA SINTESÍS DE CDNA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1150, "currency": "MXN" } } }, { "id": "0", "description": "PESO MOLECULAR (MEZCLA DE NUEVE PROTEÍNAS TEÑIDAS DE AZUL, NARANJA Y VERDE (DE 10 KDA A 250 KDA)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1491, "currency": "MXN" } } }, { "id": "0", "description": "ADN POLIMERASA PLATINUM TAQ", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2233, "currency": "MXN" } } }, { "id": "0", "description": "ALL BLUE PRESTAINED PROTEIN STANDARDS, VALUE PACK.. 2.5 ML (5 X 500 µL), MIXTURE OF TEN BLUE-STAINED RECOMBINANT PROTEINS (10–250 KD), INCLUDING THREE REFERENCE BANDS (25, 50, 75 KD), 250 APPLICATIONS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1491, "currency": "MXN" } } }, { "id": "0", "description": "MARCADOR DE PROTEÍNAS PRECISION PLUS PROTEIN DUAL COLOR STANDARDS, 500 UL, 50 APLICACIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1491, "currency": "MXN" } } }, { "id": "0", "description": "PROTEINASE K EN POLVO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 741, "currency": "MXN" } } }, { "id": "0", "description": "PROTEINASE K SOLUTION", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 741, "currency": "MXN" } } }, { "id": "0", "description": "HIGH-FIDELITY DNA POLYMERASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9366, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE ÁCIDOS NUCLÉICOS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 990, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE ÁCIDOS NUCLÉLICOS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 990, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER, SCA2B; 5´-CGG GCT TGC GGA CAT TGG- 3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1346, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 18 MER; JPH3R; 5´- AGATGCCACCGCATTCGG -3'", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1267, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 19 MER, ABC2677R1 ; 5’-GTT TGA CTC ACC TTC CCA G-3’", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1282, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC1236R; 5’-CCT GAC TCA CCA CAC CAA TG-3’", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1298, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC2677F; 5’-TGC AGG CTA TAG GTT CCA GG-3’", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1298, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC3435F ; 5’-TGT TTT CAG CTG CTT GAT GG-3’", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1298, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, ABC3435R; 5’-AAG GCA TGT ATG TTG GCC TC-3’", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1298, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, CYP3A4*1BF; 5´-TCC AGG CAT AGG TAA AGA TC-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1298, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER, SCA7R; 5´-ACT TCA GGA CTG GGC AGA GG-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1298, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; C677T-R; 5'-AGG ACG GTG CGG TGA GAG TG-3’", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1298, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; PRNPF; 5´- GATGCTGGTTCTCTTTGTGG -3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1298, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; PRNPR; 5´- CCCACTATCAGGAAGATGAG -3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1298, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; SCA17R; 5´- TTG ACT GCT GAA CGG CTG CA-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1298, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 20 MER; TBP-R; 5´- GGGACGTTGACTGCTGAAC -3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1282, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 21 MER, CYP3A4*1BR; 5´-AAT CTA TTA AAT CGC CTC TCA-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1313, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 21 MER, CYP3A5*3F; 5'-CAT CAG TTA GTA GAC AGA TGA-3'", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1313, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 22 MER, ABC1236F; 5’-TAT CCT GTC TCT GTG AAT TGC C-3’", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1328, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 22MER ; MJD255; 5'-TGG CCT TTC ACA TGG ATG TGA A-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1328, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; A1298T-R; 5'-CAC TTT GTG ACC ATT CCG GTT TG-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1344, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 23 MER; C677T-F: 5'-TGA AGG AGA AGG TGT CTG CGG GA-3’", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1344, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 24 MER; A1298T-F; 5'-CTT TGG GGA GCT GAA GGA CTAC TAC-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1375, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 24 MER; ATN1R; 5´- TGCTCCAGGAGGAGGGGGCCCAGA -3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1375, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDO 25 MER; TPR2 (TAIL); 5´-AGA ATA GAA TAG AAT AGA ATA GAA T-3´", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1375, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS DE OLIGONUCLEÓTIDOS 25 MER, APOE-F; 5’-TAA GCT TGG CAC GGC TGT CCA AGG A-3'", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1375, "currency": "MXN" } } }, { "id": "0", "description": "SÍNTESIS  DE OLIGONUCLEÓTIDO 21 MER, CYP3A5*3R; 5'-GGT CCA AAC AGG GAA GAA ATA-3'", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1313, "currency": "MXN" } } }, { "id": "0", "description": "T4 POLYNUCLEOTIDE KINASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 675, "currency": "MXN" } } }, { "id": "0", "description": "T7 DNA LIGASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 541, "currency": "MXN" } } }, { "id": "0", "description": "TRIZOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3633, "currency": "MXN" } } }, { "id": "0", "description": "WESTERN BLOTTING LUMINOL REAGENT IS A NON-RADIOACTIVE, LIGHT-EMITTING SYSTEM FOR DETECTING PROTEINS ON A WESTERN BLOT MEMBRANE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2483, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN XHOI", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1425, "currency": "MXN" } } }, { "id": "0", "description": "GEL DNA RECOVERY KIT (50 PREP)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1150, "currency": "MXN" } } }, { "id": "0", "description": "CASPASE 3 COLORIMETRIC ACTIVITY ASSAY KIT,", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15100, "currency": "MXN" } } }, { "id": "0", "description": "CASPASE 9 COLORIMETRIC ACTIVITY ASSAY KIT,", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15100, "currency": "MXN" } } }, { "id": "0", "description": "ANTIBODY LABELING KITS 594 NM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14971, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE EXTRACCIÓN DE DNA DE SANGRE COLUMNAS DE MEMBRANA DE SILICA MAXI SPIN CAPACIDAD 10ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4983, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE SUSTRATO QUIMIOLUMINISCENTE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2483, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA HEXOQUINASA, 100 PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15702, "currency": "MXN" } } }, { "id": "0", "description": "FS DNA LIBRARY PREP KIT FOR ILLUMINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2883, "currency": "MXN" } } }, { "id": "0", "description": "KIT PARA PCR DE 200 PRUEBAS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2066, "currency": "MXN" } } }, { "id": "0", "description": "SUPERMEZCLA DE IQ-SYBR GREEN PARA 50 REACCIONES DE RT-PCR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1100, "currency": "MXN" } } }, { "id": "0", "description": "TOTAL RNA PURIFICATION PLUS KIT (50). 50 PREPS.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3816, "currency": "MXN" } } }, { "id": "0", "description": "DNA SEQUENCING CLEAN-UP KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1150, "currency": "MXN" } } }, { "id": "0", "description": "PLASMID MIDIPREP KIT, 50 PREPS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6650, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS UNIVERSALES PARA MICROPIPETA DE 0.1 A 10 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 460, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO/CULTIVO DE POLIESTIRENO DE 12.5 CM2; VENT. FILTRO EN LA TAPA.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3027, "currency": "MXN" } } }, { "id": "0", "description": "BOTELLA DE ALMACENAMIENTO RESISTENTE AL CALOR, CON BOCA ANCHA. DE 100 MLILITROS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 531, "currency": "MXN" } } }, { "id": "0", "description": "BOTELLA DE ALMACENAMIENTO RESISTENTEAL CALOR, CON BOCA ANCHA. PIREX DE 250MILILITROS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1007, "currency": "MXN" } } }, { "id": "0", "description": "BOTELLA DE ALMACENAMIENTO RESISTENTEAL CALOR, CON BOCA ANCHA. DE 500 MLILITROS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1188, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS DE POLIESTIRENO DE 48 POZOS TRATADAS ESTÉRILES, LIBRES DE\nPIROGÉNOS PARA CULTIVO CELULAR", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2437, "currency": "MXN" } } }, { "id": "0", "description": "PLACA DE CULTIVO CELULAR CON TAPA DE POLIESTIRENO, DE 96 POZOS, TRATADO CON TC, FONDO REDONDO \"U\", ESTERIL. EMPACADAS INDIVIDUALMENTE", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1353, "currency": "MXN" } } }, { "id": "0", "description": "CAJAS DE POLIESTIRENO DE 6 POZOS ESTÈRILES, LIBRES DE PIROGÈNOS PARA CULTIVO CELULAR", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1358, "currency": "MXN" } } }, { "id": "0", "description": "CUCHILLAS DESECHABLES DE ACERO INOXIDABLE ALTO PERFIL ULTRAFINAS;", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381, "currency": "MXN" } } }, { "id": "0", "description": "BOTELLA DE POLIESTIRENO DE 25MM CON FILTRO, PARA CULTIVO CELULAR", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1513, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO. VIDRIO. TIPO SCHOTT. AUTOCLAVEABLE. BOCA ANCHA. CON TAPA. CAJA C/5 PZAS. 500 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 607, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO. VIDRIO. AUTOCLAVEABLE. TIPO SCHOTT. BOCA ANCHA. CON TAPA. CAJA C/10 PZAS. 250 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1075, "currency": "MXN" } } }, { "id": "0", "description": "HOMOGENEIZADOR DE VIDRIO CON PISTILO DE TEFLÓN DE 5 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1910, "currency": "MXN" } } }, { "id": "0", "description": "PARAFINA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 223, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS SEROLOGICAS DE 25 ML ESTERIL FABRICADO DE POLIESTIRENO 100% VIRGEN ULTRA TRANSPARENTE P/MÁX IMA CLARIDAD, EMPAQUE INDIVIDUAL, LIBRE DE RNASA/DNASA, ADN HUMANO, NO CITOTÓX ICO, NO PIROGÉNICO, GARANTIZA UNA PRECISIÓN DE DISPENSACIÓN DE +/-1 %, CAJA CON 100", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 735, "currency": "MXN" } } }, { "id": "0", "description": "PIPETEADORES ELÉCTRICOS. CAPACIDAD 0.1 A 100 ML CONTROLADOR DE PIPETA ELÉCTRICA, RELLENO AUTOMÁTICO DE PIPETAS MOTORIZADAS, PIPETA ELÉCTRICA, 0,1-100 ML, VELOCIDAD AJUSTABLE CON FILTRO, 115V.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1408, "currency": "MXN" } } }, { "id": "0", "description": "PISETA DE PLÁSTICO. 500 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 133, "currency": "MXN" } } }, { "id": "0", "description": "PLACA DE CON 96 POZOS DE POLIESTIRENO, NEGRAS DE FONDO TRANSPARENTE. DESECHABLES, GRADO BIOMÉDICO. PARA ENSAYO TIPO ELISA.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2872, "currency": "MXN" } } }, { "id": "0", "description": "PLACAS PARA CULTIVO CELULAR CON 96 POZOS.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 676, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA PIPETAS ESTERIL CON FILTRO 1000 UL", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1031, "currency": "MXN" } } }, { "id": "0", "description": "TAMIZ O SEPARADOR DE CÉLULAS, DE NYLON Y POLIPROPILENO; ESTÉRIL DE 100 MICRÓMETROS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1247, "currency": "MXN" } } }, { "id": "0", "description": "TAMIZ O SEPARADOR DE CÉLULAS, DE NYLON Y POLIPROPILENO; ESTÉRIL DE 70 MICRÓMETROS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1247, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE MICROCENTRIFUGA DE FONDO\nCONICO, TRANSPARENTE, TAPA A PRESION,DE POLIPROPILENO, 1.5 ML, RCF 30000 XG. AUTOCLAVABLES A 121 ° C A 15 PSI. DURANTE 20\nMINUTOS, Y SE ALMACENA A -80 ° C.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 700, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS DE POLIPROPILENO DE 5ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 528, "currency": "MXN" } } }, { "id": "0", "description": "NAVAJAS PARA MICROTOMO DE ALTO PERFIL", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1381, "currency": "MXN" } } }, { "id": "0", "description": "PICETA DE POLIETILENO 1L", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 133, "currency": "MXN" } } }, { "id": "0", "description": "PLACAS DE 96 POZOS BLANCAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1006, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA DE 1 µL A 200 µL BLANCAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 197, "currency": "MXN" } } }, { "id": "0", "description": "N,N,N',N'-TETRAMETHYLETHYLENEDIAMINE (TEMED)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 783, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, ESTERIL Y DESECHABLE DE 22G X 1.5 \" ( 0.7 X 38 MM ) COLOR NEGRO REF. 360211", "classification": { "scheme": "CUCOP", "id": "25501-0105", "description": "AGUJA PARA TOMA MULTIPLE" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 203, "currency": "MXN" } } }, { "id": "0", "description": "AGUJAS PARA TOMA DE MUESTRAS SANGRE AL VACÍO 21 G X 38 MM (VERDE)", "classification": { "scheme": "CUCOP", "id": "25501-0105", "description": "AGUJA PARA TOMA MULTIPLE" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 203, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA PASTEUR CORTA", "classification": { "scheme": "CUCOP", "id": "25501-0031", "description": "PIPETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 96, "currency": "MXN" } } }, { "id": "0", "description": "PIPETA PASTEUR LARGA", "classification": { "scheme": "CUCOP", "id": "25501-0031", "description": "PIPETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 141, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA PIPETAS AUTOMÁTICAS VOLUMEN 1 A 10 ML", "classification": { "scheme": "CUCOP", "id": "25501-0095", "description": "PUNTAS PARA MICROPIPETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3193, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACIO CON ANTICOAGULANTE EDTA (TAPÓN LILA) 4 ML. DE PLÁSTICO, DESECHABLE, CON TAPÓN DE SEGURIDAD Y VOLUMEN DE DRENADO AJUSTADO AL ANTIPLANO MEXICANO. SE SUGIERE MARCA BD VACUTAINER PLUS.", "classification": { "scheme": "CUCOP", "id": "25501-0048", "description": "TUBO MUESTRADOR" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 186, "currency": "MXN" } } }, { "id": "0", "description": "TUBO AL VACIO SIN ANTICOAGULANTE (TAPÓN ROJO) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 6 ML. SE SUGIERE MARCA BD VACUTAINER PLUS.", "classification": { "scheme": "CUCOP", "id": "25501-0048", "description": "TUBO MUESTRADOR" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 202, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA EMG, CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMG50.PARA EQUIPO CADWELL. SE REQUIERE MUESTRA FÍSICA", "classification": { "scheme": "CUCOP", "id": "25501-0105", "description": "AGUJA PARA TOMA MULTIPLE" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 8481.2, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA ESTUDIOS NEUROFISIOLÓGICOS CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMF37. SE REQUIERE MUESTRA FÍSICA", "classification": { "scheme": "CUCOP", "id": "25501-0105", "description": "AGUJA PARA TOMA MULTIPLE" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 8481.2, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA CONCENTRICA MONOPOLAR DESECHABLE PARA ESTUDIOS NEUROFISIOLÓGICOS, CON CONECTOR DIN DE 1.5 MM DE SEGURIDAD CALIBRE FINO MOD 902-DMG37. SE REQUIERE MUESTRA FÍSICA", "classification": { "scheme": "CUCOP", "id": "25501-0105", "description": "AGUJA PARA TOMA MULTIPLE" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 8481.2, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DE ANILLO PARA NEUROCONDUCCIÓN SENSITIVA DESECHABLE. NECESARIO MUESTRA FÍSICA (ELECTRODO DE TIERRA CON TERMINACION EN ARGOLLA DE ACERO INOXIDABLE", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2192, "currency": "MXN" } } }, { "id": "0", "description": "ELECTRODOS DE TIERRA DESECHABLE PARA LA REALIZACIÓN DE ESTUDIOS NEUROFISIOLÓGICOS. NECESARIO MUESTRA FÍSICA UN PAR EN CADA PAQUETE", "classification": { "scheme": "CUCOP", "id": "25501-0086", "description": "ELECTRODO PARA IONES ESPECIFICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3288, "currency": "MXN" } } }, { "id": "0", "description": "SENSOR DE RONQUIDO CON SEÑAL DE SALIDA NO MAYOR A 1000 MV PICO DIAMETRO MAYOR A 200 MV CON CONECTOR DIN DE 1.5 MM, (SENSOR PARA MEDICIÓN DE SUEÑO) NECESARIO MUESTRA FISICA", "classification": { "scheme": "CUCOP", "id": "25501-0094", "description": "SENSOR OPTICO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 10764, "currency": "MXN" } } }, { "id": "0", "description": "PAPEL SEDA PARA LIMPIAR LOS OBJETIVOS DEL MICROSCOPIO, BLOCK CON 100 HOJAS DE 10 X 15 CM", "classification": { "scheme": "CUCOP", "id": "25501-0098", "description": "PAPEL FILTRO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 65.84, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO. 50 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 118, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO. GRADUADA. 100 ML", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 135, "currency": "MXN" } } }, { "id": "0", "description": "PICETA DE POLIETILENO 250 ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 95, "currency": "MXN" } } }, { "id": "0", "description": "PICETA DE POLIETILENO 500ML", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 110.66, "currency": "MXN" } } }, { "id": "0", "description": "PARAFINA, PAQUETE DE 1 KG.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 409, "currency": "MXN" } } }, { "id": "0", "description": "HIDROXIDO DE SODIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 183, "currency": "MXN" } } }, { "id": "0", "description": "CLORURO DE CALCIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 299, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO DIBÁSICO DE SODIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 506, "currency": "MXN" } } }, { "id": "0", "description": "EOSINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 580, "currency": "MXN" } } }, { "id": "0", "description": "ORANGE G (25 G)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 183, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-TSH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 20631.74, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO BETA CATENINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 20901.64, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD20 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9086.36, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD30 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9266.29, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD45 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9086.36, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD68 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9086.36, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CK 5/6 COCKTAIL PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15893.64, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CK-LMW PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11455.42, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO EMA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9266.29, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO FACTOR VIII PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8216.71, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO IDH1-R132H PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 40993.6, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO KI-67 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12475.01, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO OLIG2 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 23180.72, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SINAPTOFISINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14934.02, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO TTF1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9266.29, "currency": "MXN" } } }, { "id": "0", "description": "AZUL DE CRESIL BRILLANTE AL 1%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3145.84, "currency": "MXN" } } }, { "id": "0", "description": "PARAFINA PARAPLAST, HISTOPLAST, MERCK O SAKURA, CON PUNTO DE FUSIÓN 56°-58°C, PRESENTACIÓN EN LENTEJAS PARA USO EN EQUIPO CENTRO DE INCLUSIÓN LEICA MODELO EG1160 PROPIEDAD DEL INNN", "classification": { "scheme": "CUCOP", "id": "24101-0126", "description": "PARAFINA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "24101", "description": "PRODUCTOS MINERALES NO METÁLICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 409, "currency": "MXN" } } }, { "id": "0", "description": "XILOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2433.33, "currency": "MXN" } } }, { "id": "0", "description": "MATRAZ ERLENMEYER DE VIDRIO CON TAPÓN DE ROSCA DE 500 ML", "classification": { "scheme": "CUCOP", "id": "25501-0024", "description": "MATRAZ" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 553.33, "currency": "MXN" } } }, { "id": "0", "description": "PROBETA DE VIDRIO 50 ML", "classification": { "scheme": "CUCOP", "id": "25501-0037", "description": "PROBETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 119.33, "currency": "MXN" } } }, { "id": "0", "description": "FILTRO DE PIRINOLA (FILTRO PARA JERINGA) DE 28 MM Y 0.20 MICRAS MEMBRANA CFSA NO PIROGHENICOS ESTERIL, EMPAQUETADOS INDIVIDUALMENTE.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1265, "currency": "MXN" } } }, { "id": "0", "description": "FRASCO DE CULTIVO CELULAR DE POLIESTIRENO, 75 CM2, ESTÉRIL, TRATADOS P/CULTIVO Y FILTRO DE VENTILACIÓN EN LA TAPA.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1090, "currency": "MXN" } } }, { "id": "0", "description": "TUBO P/CENTRIFUGA 15ML DE POLIPROPILENO FONDO CONICO, TAPÓN DE ROSCA ESTÉRILES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1600, "currency": "MXN" } } }, { "id": "0", "description": "1,4 DITIOTREITOL (DTT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1665.18, "currency": "MXN" } } }, { "id": "0", "description": "TEMED (50 ML) ULTRAPURO, GRADO BIOLOGIA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1085.76, "currency": "MXN" } } }, { "id": "0", "description": "10X TRIS/GLYCINE/SDS. BIORAD. PKG OF 1, 1 L, 10X PREMIXED ELECTROPHORESIS BUFFER, CONTAINS 25 MM TRIS, 192 MM GLYCINE, 0.1% SDS, PH 8.3 FOLLOWING DILUTION TO 1X WITH WATER.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 574.74, "currency": "MXN" } } }, { "id": "0", "description": "2X LAEMMLI SAMPLE BUFFER.30 ML, PREMIXED PROTEIN SAMPLE BUFFER FOR SDS-PAGE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 347.58, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANA DE NITROCELULOSA 0.4 UM\n30 CM X 3.5 M", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 6449.04, "currency": "MXN" } } }, { "id": "0", "description": "ROLLO DE MEMBRANA PVDF PARA WESTERN BLOT 0.2 µM, 26 CM X 3.3 M", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 7938, "currency": "MXN" } } }, { "id": "0", "description": "MINI-PROTEAN COMB, 10-WELL, 0.75 MM, 33 ¿L. PKG OF 5, COMBS FOR MINI-PROTEAN ELECTROPHORESIS CELL, USE WITH 0.75 MM GLASS PLATES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 740.7, "currency": "MXN" } } }, { "id": "0", "description": "MINI-PROTEAN SHORT PLATES.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 517.14, "currency": "MXN" } } }, { "id": "0", "description": "MINI-PROTEAN SHORT PLATES. PKG OF 5, SHORT PLATE FOR MINI-PROTEAN TETRA SYSTEM AND MINI-PROTEAN 3 MULTI-CASTING CHAMBER.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 517.14, "currency": "MXN" } } }, { "id": "0", "description": "MINI-PROTEAN SPACER PLATES WITH 1.0 MM INTEGRATED SPACERS. PKG OF 5, SPACER PLATE WITH 1.0 MM INTEGRATED SPACER, FOR MINI-PROTEAN TETRA SYSTEM AND MINI-PROTEAN 3 MULTI-CASTING CHAMBER.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1098.72, "currency": "MXN" } } }, { "id": "0", "description": "MINI-PROTEAN CASTING FRAME", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 760.5, "currency": "MXN" } } }, { "id": "0", "description": "MINI-PROTEAN CASTING FRAME", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 760.5, "currency": "MXN" } } }, { "id": "0", "description": "SUPPORTED NITROCELLULOSE MEMBRANE", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 6449.04, "currency": "MXN" } } }, { "id": "0", "description": "VIDRIOS DELGADOS MINI PROTEAN SHORT PLATES", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 517.14, "currency": "MXN" } } }, { "id": "0", "description": "VIDRIOS ESPACIADOR DE 0.75 MM MINI PROTEAN SPACER PLATES WITH 0.75 MM", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1335.78, "currency": "MXN" } } }, { "id": "0", "description": "AMMONIUM PERSULFATE (APS). CATALYST.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 329.94, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN DE AZUL BRILLANTE DE COOMASSIE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1164.6, "currency": "MXN" } } }, { "id": "0", "description": "(TUBO AL VACIÓ CON ANTICOAGULANTE (EDTA, TAPÓN MORADO ) PARA LA TOMA DE SANGRE, DE PLÁSTICO, DE INTERIOR ESTÉRIL, DESECHABLE Y TAPÓN DE SEGURIDAD, CON VOLUMEN DE DRENADO DE 6 ML. S", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 618, "currency": "MXN" } } }, { "id": "0", "description": "15ML TUBO CENTRÍFUGA STANDARD ESTERIL DNASE/RNASE FREE", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1500, "currency": "MXN" } } }, { "id": "0", "description": "ACETONA EN ENVASE DE PLÁSTICO. PRESENTACION DE 4 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1178, "currency": "MXN" } } }, { "id": "0", "description": "FORMALDEHIDO EN SOLUCIÓN AL 36-38% PORRÓN 20 LITROS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5860, "currency": "MXN" } } }, { "id": "0", "description": "AGUJA PARA TOMA Y RECOLECCION DE SANGRE SENCILLA Y/O MULTIPLE, CON CAMARA DE VISUALIZACION DE FLUJO, ESTERIL Y DESECHABLE DE 21G X 1 \" ( 0.8 MM X 25 MM) COLOR VERDE REF. 301746", "classification": { "scheme": "CUCOP", "id": "25501-0105", "description": "AGUJA PARA TOMA MULTIPLE" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 390.32, "currency": "MXN" } } }, { "id": "0", "description": "BASE PARA TUBO TIPO VACUTAINER", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 96.39, "currency": "MXN" } } }, { "id": "0", "description": "CAMARA DE FUSCH ROSENTHAL CUADRICULA DOBLE", "classification": { "scheme": "CUCOP", "id": "25501-0092", "description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 8400, "currency": "MXN" } } }, { "id": "0", "description": "EQUIPO ALADO ULTRA-TOUCH PARA TOMA DE MUESTRAS SANGUINEAS AL VACIO CON AGUJA NO. 23 G X .75 CON TUBO DE PLASTICO FLEXIBLE DE 7\"(AZUL CLARO) CON TECNOLOGIA DE PARED ULTRAFINA RIGTHGAUGE QUE PERMITE UTILIZAR CALIBRES MAS PEQUEÑOS PARA LOS ACCESOS VENOSOS DIFICILES Y CON DISEÑO PENTAPOINT DE 5 BISELES EL CUAL DISMINUYE LA FUERZA DE PENETRACIÓN DE LA AGUJA CON SISTEMA DE BOTÓN DE SEGURIDAD PARA LA RETRACCIÓN DE LA AGUJA (\"PUSH BUTTON\")", "classification": { "scheme": "CUCOP", "id": "25501-0105", "description": "AGUJA PARA TOMA MULTIPLE" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1658.86, "currency": "MXN" } } }, { "id": "0", "description": "GUANTES DE NITRILO LIBRE DE TALCO. TALLA CHICA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 101.46, "currency": "MXN" } } }, { "id": "0", "description": "GUANTES DE NITRILO LIBRE DE TALCO. TALLA MEDIANA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 101.46, "currency": "MXN" } } }, { "id": "0", "description": "SENSOR DE TEMPERATURA ESOFAGICO REUSABLE. AISYS CSZ. PARTE M1024254", "classification": { "scheme": "CUCOP", "id": "25501-0094", "description": "SENSOR OPTICO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 4454.4, "currency": "MXN" } } }, { "id": "0", "description": "SENSOR DE TEMPERATURA ESOFAGICO REUSABLE. AISYS CSZ. 3 PARTE M1024247", "classification": { "scheme": "CUCOP", "id": "25501-0094", "description": "SENSOR OPTICO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 7020, "currency": "MXN" } } }, { "id": "0", "description": "SENSOR NEONATAL/ADULTO PARA LA MEDICIÓN DE SPHB, SPO2, SPMET. PARA USO EN EQUIPO MARCA MASIMO, MODELO RAINBOW (R1 25L)", "classification": { "scheme": "CUCOP", "id": "25501-0094", "description": "SENSOR OPTICO" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 34656, "currency": "MXN" } } }, { "id": "0", "description": "JUEGO DE 3 PIPETAS.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 7600, "currency": "MXN" } } }, { "id": "0", "description": "SUTURA CATGUT CRÓMICO 4-0", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1600, "currency": "MXN" } } }, { "id": "0", "description": "SUTURA NYLON 4-0", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1792, "currency": "MXN" } } }, { "id": "0", "description": "SUTURA QUIRÚRGICA SEDA PRETA/NEGRA TRENZADA CON AGUJA 4-0", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2112, "currency": "MXN" } } }, { "id": "0", "description": "SUTURA SEDA 4-0", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2016, "currency": "MXN" } } }, { "id": "0", "description": "AMPK¿ ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8202, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN HPH I", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1900, "currency": "MXN" } } }, { "id": "0", "description": "ENZIMA DE RESTRICCIÓN PMEI", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2202, "currency": "MXN" } } }, { "id": "0", "description": "T4 DNA LIGASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1872, "currency": "MXN" } } }, { "id": "0", "description": "M-MLV TRANSCRIPTASA INVERSA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2174, "currency": "MXN" } } }, { "id": "0", "description": "PROTEINASA K EN SOLUCIÓN DE 20 MG / ML, VIAL DE 1.0 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2505, "currency": "MXN" } } }, { "id": "0", "description": "2,-(4-HYDROXYPHENYLAZO) BENZOIC ACID PUREZA \t= 90 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 715.3, "currency": "MXN" } } }, { "id": "0", "description": "3-INDOLEPROPIONIC ACID ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 766.6, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO BICINCONINICO (SOLUCIÓN) ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10330, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO NITRICO70%, ALTA PUREZA PURIFIED BY REDISTILLATION, =99.999% TRACE METALS BASIS", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3573.7, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO VALPROICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 16749.7, "currency": "MXN" } } }, { "id": "0", "description": "INDOLE-3-PYRUVIC ACID PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14469.1, "currency": "MXN" } } }, { "id": "0", "description": "ACRILAMIDA.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3135.4, "currency": "MXN" } } }, { "id": "0", "description": "AMERSHAM ECL RAINBO MARKER - FULL RANGE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3759.1, "currency": "MXN" } } }, { "id": "0", "description": "BETA-MERCAPTOETANOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 455.2, "currency": "MXN" } } }, { "id": "0", "description": "CATALASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 16426.6, "currency": "MXN" } } }, { "id": "0", "description": "CHITOSAN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1856.5, "currency": "MXN" } } }, { "id": "0", "description": "DNTP MIX (10 MM EACH)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1344.4, "currency": "MXN" } } }, { "id": "0", "description": "HABA/AVIDIN REAGENT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1358.8, "currency": "MXN" } } }, { "id": "0", "description": "CYTOCHALASIN B", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2160.7, "currency": "MXN" } } }, { "id": "0", "description": "TWEEN 80", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 738.7, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANA DE NITRATO DE CELULOSA DE 0.22¿M DEL PORO. DIÁMETRO DE 47MM.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1766.85, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANA PARA FILTRACIÓN CON PORO DE 0.45 MICROMETROS, HVLP HIDROFÍLICAS DE ÉSTERES DE CELULOSA DE 47MM DE DIÁMETRO. PAQ. C/100 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1275.55, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANA PARA FILTRACIÓN DE DISOLVENTES ORGANICOS (HIDROFÓBICA) TIPO HVLP 0.45 MM. CAJA C/100 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2133.2, "currency": "MXN" } } }, { "id": "0", "description": "MEMBRANAS DE FILTRADO HIDROFÓBICAS DE PVDF, 0.22 MICRAS DE PORO Y 45 O 47 MM DE DIÁMETRO, CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2490.2, "currency": "MXN" } } }, { "id": "0", "description": "UNIDAD DE FILTRACIÓN POR VACÍO; UN EMBUDO DE VIDRIO Y UNA ABRAZADERA DE ALUMINIO. EL EMBUDO GRADUADO DE 300 ML.", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 6615.25, "currency": "MXN" } } }, { "id": "0", "description": "UNIDAD DE FILTRO DE JERINGA MILLEX-GS, 0,22 µM, DIÁMETRO 25 MM, CAJA CON 50 PZS.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 7769.55, "currency": "MXN" } } }, { "id": "0", "description": "(3-AMINOPROPYL) TRIETHOXYSILANE (APTES)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7662.4, "currency": "MXN" } } }, { "id": "0", "description": "(3-AMINOPROPYL)TRIETHOXYSILANE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2221.9, "currency": "MXN" } } }, { "id": "0", "description": "1,3-DIPHENYLISOBENZOFURAN (DPBF)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2822.2, "currency": "MXN" } } }, { "id": "0", "description": "2-4 DINITROFENOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 661.3, "currency": "MXN" } } }, { "id": "0", "description": "2-MERCAPTOETANOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1390.3, "currency": "MXN" } } }, { "id": "0", "description": "3-(TRIMETHOXYSILYL)PROPYL METHACRYLATE (SILANE)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1502.8, "currency": "MXN" } } }, { "id": "0", "description": "5-IODOTUBERCIDIN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15370, "currency": "MXN" } } }, { "id": "0", "description": "6-HYDROXYDOPAMINE HYDROBROMIDE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11277.7, "currency": "MXN" } } }, { "id": "0", "description": "8-CYCLOPENTYL-1,3-DIPROPYLXANTHINE DPCPX", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2243.5, "currency": "MXN" } } }, { "id": "0", "description": "CYTOCHALASIN D", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3706, "currency": "MXN" } } }, { "id": "0", "description": "DAPT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3440.5, "currency": "MXN" } } }, { "id": "0", "description": "DL-2-AMINO-5-PHOSPHONOPENTANOIC ACID", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6583.3, "currency": "MXN" } } }, { "id": "0", "description": "DOPAMINE HYDROCHLORIDE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1032.1, "currency": "MXN" } } }, { "id": "0", "description": "DYETHYLPYROCARBONATE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7430.2, "currency": "MXN" } } }, { "id": "0", "description": "FLUOROMOUNT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3241.6, "currency": "MXN" } } }, { "id": "0", "description": "GLUTATHIONE REDUCTASE FROM BAKER'S YEAST (S. CEREVISIAE)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2931.1, "currency": "MXN" } } }, { "id": "0", "description": "IMMOBILON CRESCENDO WESTERN HRP SUBSTRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7857.1, "currency": "MXN" } } }, { "id": "0", "description": "ISOPROPÓXIDO DE TITANIO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1938.4, "currency": "MXN" } } }, { "id": "0", "description": "LACTOTRANSFERRINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4080.4, "currency": "MXN" } } }, { "id": "0", "description": "LAMININ FROM ENGELBRETH-HOLM-SWARM MURINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4915.6, "currency": "MXN" } } }, { "id": "0", "description": "L-GLUTAMINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 647.8, "currency": "MXN" } } }, { "id": "0", "description": "L-GLUTATIÓN OXIDADO (GSSG)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4746.4, "currency": "MXN" } } }, { "id": "0", "description": "LIPOPOLYSACCHARIDES FROM ESCHERICHIA COLI O111:B4", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9454.3, "currency": "MXN" } } }, { "id": "0", "description": "TARIQUIDAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11799.7, "currency": "MXN" } } }, { "id": "0", "description": "TAURINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2104.9, "currency": "MXN" } } }, { "id": "0", "description": "THIOUREA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1093.3, "currency": "MXN" } } }, { "id": "0", "description": "WIN 55,212-2", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10216.6, "currency": "MXN" } } }, { "id": "0", "description": "XANTINA -FRASCO DE 25MG (XANTHINE =99%)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3674.5, "currency": "MXN" } } }, { "id": "0", "description": "XANTINE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2164.3, "currency": "MXN" } } }, { "id": "0", "description": "XANTINE OXIDASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3049.9, "currency": "MXN" } } }, { "id": "0", "description": "CLOROQUINA SAL DIFOSFATADA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3475.6, "currency": "MXN" } } }, { "id": "0", "description": "4-NITRO BLUE TETRAZOLIUM CHLORIDE, CRYSTALS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3158.8, "currency": "MXN" } } }, { "id": "0", "description": "PIRUVATO DE SODIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1420.9, "currency": "MXN" } } }, { "id": "0", "description": "PERSULFATO DE AMONIO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 763.9, "currency": "MXN" } } }, { "id": "0", "description": "HEXADECYLTRIMETHYLAMMONIUM BROMIDE (CTAB)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7933.3, "currency": "MXN" } } }, { "id": "0", "description": "N-HIDROXISULFOSUCCINIMIDA (SULFO- NHS)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3238, "currency": "MXN" } } }, { "id": "0", "description": "2,6 DICLOROFENOLINDOFENOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4044, "currency": "MXN" } } }, { "id": "0", "description": "HIDROSULFITO DE SODIO (DT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1729.6, "currency": "MXN" } } }, { "id": "0", "description": "2,3,5-TRIPHENYLTETRAZOLIUM CHLORIDE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2130.1, "currency": "MXN" } } }, { "id": "0", "description": "2',7'-DICHLOROFLUORESCEIN, FRASCO DE 5 GR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2130.1, "currency": "MXN" } } }, { "id": "0", "description": "4-NITRO BLUE TETRAZOLIUM CHLORIDE, CRYSTALS, FRASCO 250MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3158.8, "currency": "MXN" } } }, { "id": "0", "description": "DAPI", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1427.2, "currency": "MXN" } } }, { "id": "0", "description": "FLUORESCEIN ISOTHIOCYANATE (FITC)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10295.8, "currency": "MXN" } } }, { "id": "0", "description": "HEMATOXILINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3065.2, "currency": "MXN" } } }, { "id": "0", "description": "O-FTALADEHÍDO = 98% , FRASCO 5 GR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14998.3, "currency": "MXN" } } }, { "id": "0", "description": "PONCEAU-S, SODIUM SALT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2879.8, "currency": "MXN" } } }, { "id": "0", "description": "PROPIDIUM IODIDE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4729.3, "currency": "MXN" } } }, { "id": "0", "description": "REACTIVO DE SCHIFF", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 805.5, "currency": "MXN" } } }, { "id": "0", "description": "3-INDOLEACETIC ACID PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3420, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO HOMOVANÍLICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 524, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO XANTURÉNICO ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1482, "currency": "MXN" } } }, { "id": "0", "description": "IRON(III) CHLORIDE", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 912, "currency": "MXN" } } }, { "id": "0", "description": "TRIETILAMINA", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2227, "currency": "MXN" } } }, { "id": "0", "description": "(+)-MK-801HYDROGEN MALEATE 25MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7729, "currency": "MXN" } } }, { "id": "0", "description": "APOMORFINA", "classification": { "scheme": "CUCOP", "id": "25301-3467", "description": "040.000.6215.00 CLORHIDRATO DE APOMORFINA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25301", "description": "MEDICINAS Y PRODUCTOS FARMACÉUTICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6080, "currency": "MXN" } } }, { "id": "0", "description": "BENZONATATO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7524, "currency": "MXN" } } }, { "id": "0", "description": "CARBAMAZEPINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1459, "currency": "MXN" } } }, { "id": "0", "description": "CEFOPERAZONA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1254, "currency": "MXN" } } }, { "id": "0", "description": "GABAPENTINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2736, "currency": "MXN" } } }, { "id": "0", "description": "GENISTEÍNA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 570, "currency": "MXN" } } }, { "id": "0", "description": "LEVETIRACETAM", "classification": { "scheme": "CUCOP", "id": "25301-4394", "description": "LEVETIRACETAM" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25301", "description": "MEDICINAS Y PRODUCTOS FARMACÉUTICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7729, "currency": "MXN" } } }, { "id": "0", "description": "LUMEFANTRINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2736, "currency": "MXN" } } }, { "id": "0", "description": "NITAZOXANIDA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2736, "currency": "MXN" } } }, { "id": "0", "description": "PENTILENTETRAZOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3002, "currency": "MXN" } } }, { "id": "0", "description": "SAQUINAVIR, FRASCO DE 10 MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1801, "currency": "MXN" } } }, { "id": "0", "description": "TEMOZOLOMIDE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5472, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ACTIN (C-2)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ANTI RABBIT ACOPLADO A ALEXA 488", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3493, "currency": "MXN" } } }, { "id": "0", "description": "AMINOBUTYRIC ACID MONOCLONAL ANTIBODY (5A9) 25 ¿G", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2599, "currency": "MXN" } } }, { "id": "0", "description": "ANTCUERPO: MAP LC3¿/B (G-4).", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI - TIROSINA HIDROXILASA RABBIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI GALECTINA3", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-BCL-2 (C-2) ANTICUERPO MONOCLONAL IGG1 (KAPPA LIGHT CHAIN) BCL-2 ANTIBODY.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUEPO ANTI-CONNEXIN 43 (D-7)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI ACTINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI ALFA ACTINA HUMANA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI TNF ALFA DE HUMANO, RATON, RATA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI FACTOR VON WILLEBRAND /VWF", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-CASPASA 3", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-FGF-2", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-OCCLUDIN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-TIROSINA HIDROXILASA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-VEGFA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-ZO-1", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO BCL-2 ANTIBODY (1N2), N-TERM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CASPASE 3 ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CASPASE 9 ANTIBODY (N2C3)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CAVEOLIN-3", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO DYSTROPHIN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO INTEGRINA BETA1", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MONOCLONAL DE RATON ANTI-VDAC1 CLONA (B-6) ISOTIPO IGG1 (CADENA LIGERA KAPPA)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO OPA1", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PROHIBITIN ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ACOPLADO A HRP ANTI-CONEJO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3466, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SECUNDARIO ACOPLADO A HRP ANTI-HUMANO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3845, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ¿-SARCOGLYCAN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ¿-SARCOGLYCAN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO G-SARCOGLYCAN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ¿-SARCOGLYCAN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO: ATG7 ANTIBODY (B-9).", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO: ANTI-BAX.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO: ANTI-CYCLIN D3 (18B6-10).", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO: WAF1/CIP1/CDKN1A P21.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ATRX ANTIBODY (D-5), MOUSE MONOCLONAL IGG2A", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "BAX ANTIBODY (B9), MOUSE MONOCLONAL IGG2B", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTIBODY CASPASE-3 ANTIBODY (E-8), MOUSE MONOCLONAL IGG2A", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI CASPASA-8, MONOCLONAL DE RATÓN IGG1 (KAPPA LIGHT CHAIN)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD8 (HUMAN, MOUSE, RAT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO C-FMS/CSF-1R ACOPLADOA ALEXA FLUOR 594", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7843, "currency": "MXN" } } }, { "id": "0", "description": "CMYC ANTIBODY (HUMAN, MOUSE, RAT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CYCLIN D1", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "CYTOCHROME C ANTIBODY (7H8), MOUSE MONOCLONAL IGG2B.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "E-CALDHERIN ANTIBODY (G-10) IS A GOAT, MOUSE MONOCLONAL IGG1 (KAPPA LIGHT CHAIN)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ERBB2/HER2 ACOPLADO A ALEXAFLUOR 680", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7843, "currency": "MXN" } } }, { "id": "0", "description": "FLUORESCEIN (FITC)-AFFINIPUR RABBIT ANTI-GOAT IGG (H+L).", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2653, "currency": "MXN" } } }, { "id": "0", "description": "FLUORESCEIN (FITC)-AFFINIPURE GOAT ANTI-HUMAN IGG (H+L)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2653, "currency": "MXN" } } }, { "id": "0", "description": "GLUR-2 ANTICUERPO MONOCLONAL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "GOAT ANTI-RABBIT IGG ANTIBODY (H+L), PEROXIDASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3466, "currency": "MXN" } } }, { "id": "0", "description": "HDAC1 ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "HRP ANTI-RABBIT IGG ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3466, "currency": "MXN" } } }, { "id": "0", "description": "HSP90ALPHA/BETAANTICUERPO(F-8)PE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7547, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO IBA1A ACOPLADO A LEXAFLUOR 680", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7843, "currency": "MXN" } } }, { "id": "0", "description": "IGG ANTI RATÓN HRP DE CABRA 2 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3466, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO INTEGRIN¿M/CD11B ACOPLADO A ALEXAFLUOR 488 (MOUSE, RAT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7843, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO LAMP1 ACOPLADO A ALEXAFLUOR 405", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7843, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MAB ANTI ACTINA DE RATÓN IGG1", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MAB ANTI C-SRC DE RATÓN IGG2A 200 ¿G/ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "MOUSE-ANTI GFAP/PE PRIMARY ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7547, "currency": "MXN" } } }, { "id": "0", "description": "NAVL1 ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NCAM/CD56", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "NMDA RECEPTOR NR2C SUBUNIT POLYCLONAL ANTIBODY 10 ¿G", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7971, "currency": "MXN" } } }, { "id": "0", "description": "NRF1 ANTICUERPO (H-4)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "OCCLUDIN ANTIBODY (E-5), MOUSE MONOCLONAL IGG2B (KAPPA LIGHT CHAIN)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "PAQUETEDECORONAVIRUS(FIPV3-70):M-IGGFCBP-HRP100 ¿G AB; 10 ¿G BP", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 7798, "currency": "MXN" } } }, { "id": "0", "description": "PEROXIDASE-AFFINIPURE 1.50M GOAT ANTI-RABBIT IGG (H+L)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3466, "currency": "MXN" } } }, { "id": "0", "description": "PEROXIDASE-AFFINIPURE RABBIT ANTI-GOAT IGG (H+L)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3845, "currency": "MXN" } } }, { "id": "0", "description": "PEROXIDASE-AFFINIPURE RABBIT ANTI-HUMAN IGG (H+L)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3845, "currency": "MXN" } } }, { "id": "0", "description": "RHODAMINE RED-X-AFFINIPURE GOAT ANTI-MOUSE IGG (H+L)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2653, "currency": "MXN" } } }, { "id": "0", "description": "ß-CATENIN ANTIBODY (E-5) IS A MOUSE MONOCLONAL IGG1", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "TL1A (HUMAN) MONOCLONAL ANTIBODY (L4G9), 100 ¿G,", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9595, "currency": "MXN" } } }, { "id": "0", "description": "VGLUT 1 ANTIBODY", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "WNT-2 ANTICUERPO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "COMPLETE, MINI PROTEASE INHIBITOR COCKTAIL.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3876, "currency": "MXN" } } }, { "id": "0", "description": "SOL DE LISIS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 479, "currency": "MXN" } } }, { "id": "0", "description": "TRIS (HIDROXYMETHYL)-AMINOMETHANE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1322, "currency": "MXN" } } }, { "id": "0", "description": "TRIS BASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 752, "currency": "MXN" } } }, { "id": "0", "description": "TRIS-HCI, GRADO REACTIVO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1368, "currency": "MXN" } } }, { "id": "0", "description": "TRIZMA-BASE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1322, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER DE REFERENCIA STD PARA PH 4 FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 935, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER DE REFERENCIA STD PARA PH 7 FRASCO 500 ML", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 935, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN BUFFER PH 10 PARA CALIBRACIÓN DE POTENCIÓMETRO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 935, "currency": "MXN" } } }, { "id": "0", "description": "ACTINOMYCIN D", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2364, "currency": "MXN" } } }, { "id": "0", "description": "DIMETIL SULFOXIDO GRADO BIOLOGÍA MOLECULAR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 684, "currency": "MXN" } } }, { "id": "0", "description": "DIMETILSULFOXIDO (DMSO)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5244, "currency": "MXN" } } }, { "id": "0", "description": "DUBELCCOD'S MODIFIED EAGLE'S MEDIUM-HIGH GLUCOSE.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 807, "currency": "MXN" } } }, { "id": "0", "description": "FLUORESCEIN DIACETATO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1345, "currency": "MXN" } } }, { "id": "0", "description": "GOAT SERUM.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1733, "currency": "MXN" } } }, { "id": "0", "description": "SOLUCIÓN TRIPSINA EDTA AL 2.5 % (10X)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 730, "currency": "MXN" } } }, { "id": "0", "description": "BAPTA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1778, "currency": "MXN" } } }, { "id": "0", "description": "TWEEN 20", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 274, "currency": "MXN" } } }, { "id": "0", "description": "TWEEN 20, 100% NONIONIC DETERGENT. BIORAD. 100 ML, ENZYME IMMUNOASSAY GRADE POLYSORBATE SURFACTANT (DETERGENT)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 274, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE SÍNTESIS DE CDNA PARA 50 REACCIONES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5805, "currency": "MXN" } } }, { "id": "0", "description": "NAD/NADH ASSAY KIT (COLORIMETRIC)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 17024, "currency": "MXN" } } }, { "id": "0", "description": "TGFBI (BIGH3) HUMAN ELISA KIT 96 TEST", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2158, "currency": "MXN" } } }, { "id": "0", "description": "TUBO DE 0.2 ML PARA PCR CON TAPA PLANA).", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 527, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA DE 10 UL BOLSA CON 1000 PZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 219, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA PIPETAS ESTERILES CON FILTRO 0.2 A 10 UL", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 990, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA PIPETAS ESTERILES CON FILTRO DE 20- 200 UL", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 990, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS AZULES 1000 UL, NO ESTERILES. LIBRES DE RNASAS, DNASAS Y NO PIROGENICAS. RESISTENTA A LA ESTERILIZACIÓN EN AUTOCLAVE", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 220, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBOS 0.5 ML, 1000/BLS CLAROS. DE POLIPROPILENO. AUTOCLAVABLES A 121 °C A 15 PSI. DURANTE 20 MINUTOS, Y SE ALMACENA A -80 °C.", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 330, "currency": "MXN" } } }, { "id": "0", "description": "TUBO PARA MICROCENTRIFUGA TRANSPARENTE DE 0.6 ML. BOLSA C/1000 PZAS (TIPO EPENDORF)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 330, "currency": "MXN" } } }, { "id": "0", "description": "TUBO PARA MICROCENTRIFUGA TRANSPARENTE DE 2.0 ML. BOLSA C/1000 PZAS CON TAPA (TIPO EPENDORF)", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 418, "currency": "MXN" } } }, { "id": "0", "description": "TUBOS DE PCR CON TAPÓN PLANO 100 µL TRANSPARENTES", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 527, "currency": "MXN" } } }, { "id": "0", "description": "ADHESIVE MICRO SLIDES, 72/P 692.00 34,600.00", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 517, "currency": "MXN" } } }, { "id": "0", "description": "CNQX C127-50MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10625, "currency": "MXN" } } }, { "id": "0", "description": "SR-95531 S106-50MG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11172, "currency": "MXN" } } }, { "id": "0", "description": "2-CHLORO-N6-CYCLOPENTYLADENOSINE CCPA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3078, "currency": "MXN" } } }, { "id": "0", "description": "3,4-DIHYDROXYPHENYLACETIC ACID, DOPAC", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 684, "currency": "MXN" } } }, { "id": "0", "description": "3-HYDROXY-DL-KYNURENINE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10739, "currency": "MXN" } } }, { "id": "0", "description": "AM251, CB1 RECEPTOR ANTAGONIST / INVERSE AGONIST", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3078, "currency": "MXN" } } }, { "id": "0", "description": "AM630 (CB2 ANTAGONIST)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2432, "currency": "MXN" } } }, { "id": "0", "description": "AM630, CB2 RECEPTOR ANTAGONIST", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2432, "currency": "MXN" } } }, { "id": "0", "description": "ANANDAMIDA (ANANDAMIDE-AEA)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1550, "currency": "MXN" } } }, { "id": "0", "description": "ARACHIDONYLETHANOLAMIDE (ANADAMIDA, AEA)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4583, "currency": "MXN" } } }, { "id": "0", "description": "BLOTTO, NON-FAT DRY MILK", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 821, "currency": "MXN" } } }, { "id": "0", "description": "DIALIL TRISULFURO (DI-2-PROPENYL TRISULFIDE)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8755, "currency": "MXN" } } }, { "id": "0", "description": "FCCP", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2751, "currency": "MXN" } } }, { "id": "0", "description": "GOLD (III) CHLORIDE TRIHYDRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14592, "currency": "MXN" } } }, { "id": "0", "description": "MONOACYLGLYCEROL LIPASE (MAGL) INHIBITOR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1824, "currency": "MXN" } } }, { "id": "0", "description": "L-CISTEINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2326, "currency": "MXN" } } }, { "id": "0", "description": "L-CISTEÍNA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2326, "currency": "MXN" } } }, { "id": "0", "description": "N-ETHYLMALEIMIDE CRYSTALLINE, =98% FRASCO 25 G", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5510, "currency": "MXN" } } }, { "id": "0", "description": "OLIGOMICINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6840, "currency": "MXN" } } }, { "id": "0", "description": "PENTAACETATO DE DIETILENTRIAMINA 3820", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3466, "currency": "MXN" } } }, { "id": "0", "description": "PIRIDOXAL 5 FOSFATO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1254, "currency": "MXN" } } }, { "id": "0", "description": "SB 431542", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 4674, "currency": "MXN" } } }, { "id": "0", "description": "STREPTOZOCIN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2371, "currency": "MXN" } } }, { "id": "0", "description": "Y-27632 DIHYDROCHLORIDE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 5130, "currency": "MXN" } } }, { "id": "0", "description": "ZM 241385", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9014, "currency": "MXN" } } }, { "id": "0", "description": "MTT (BROMURO DE 3-(4,5-DIMETILTIAZOL-2-IL)-2,5-DIFENILTETRAZOLIO)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2371, "currency": "MXN" } } }, { "id": "0", "description": "CARBONATO DE POTASIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 912, "currency": "MXN" } } }, { "id": "0", "description": "GUANOSINE 5’-TRIPHOSPHATE SODIUM SAL HYDRATE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1414, "currency": "MXN" } } }, { "id": "0", "description": "D-GLUCOSA 6 PHOSPHATE SODIUM", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1277, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO MONOBÁSICO DE POTASIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 456, "currency": "MXN" } } }, { "id": "0", "description": "ANNEXINV-FITC", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15963, "currency": "MXN" } } }, { "id": "0", "description": "AZUL BRILLANTE DE COOMASIE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1619, "currency": "MXN" } } }, { "id": "0", "description": "BRU (5-BROMO.2`-DEOXYURIDINE)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1505, "currency": "MXN" } } }, { "id": "0", "description": "ER-TRACKER GREEN (BODIPY FL GLIBENCLAMIDE), FOR LIVE-CELL IMAGING", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6433, "currency": "MXN" } } }, { "id": "0", "description": "SYTO 9 STAIN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 9011, "currency": "MXN" } } }, { "id": "0", "description": "TINCIÓN DE PONCEUS (PONCEUS STAIN). FCO. 500 ML.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1801, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-FSH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10436, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-LH PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10095, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-PROLACTINA (PRL) PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 13320, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO ANTI-RECEPTOR DE PROGESTERONA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 16650, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11406, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD35 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14631, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD38 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 19141, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD56 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 23467, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD57 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14421, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CD8 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12717, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CK AE1/AE3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 20058, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CK-HMW PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11406, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CLAUDINA 5 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8259, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO CMV PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10881, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO E-CADERINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12192, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO HMB45 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO INI-1 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO INSM1 CLONA A-8 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO KAPPA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10095, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO LAMBDA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 8784, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO LISOZIMA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 10095, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO MIOGENINA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15601, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NEUN FOX3 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 17567, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO NSE PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15732, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO P53 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15339, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO P65 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PLAP PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 6931, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO PS100 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 14631, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SMA PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 15339, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO STAT6 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 17436, "currency": "MXN" } } }, { "id": "0", "description": "ANTICUERPO SV40 PARA INMUNOHISTOQUÍMICA EN CORTES EN PARAFINA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 26089, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER DE REFERENCIA STD PARA PH 4 SIN COLOR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 935, "currency": "MXN" } } }, { "id": "0", "description": "BUFFER DE REFERENCIA STD PARA PH 7 SIN COLOR", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 935, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE EXTRACCIÓN DE DNA, RNA Y PROTEÍNAS A PARTIR DE TEJIDO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2705, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO ACTIN F PARA PCR CON SECUENCIA AGGGAGTATATAGGTTGGGGAAGTT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1330, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO ACTIN R PARA PCR CON SECUENCIA AACACACAATAACAAACACAAATTCAC", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1436, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO GADPH FW 5'-GAAGGTCGGAGTCAACGGATTT-3' 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1170, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO GADPH RV 5'-CTGGAAGATGGTGATGGGATT-3' 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1117, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO GB FW 5´-ACTGGAACTTTACTCGCAGAAAGA-3' 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1277, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO GB RV 3'-CTCCACGTACTTTACCCGCTG-5' 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1117, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO IE-1-A FW 5'-GAAGGCTGAGTTCTTGGTAA-3' 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO IE-1-B RV 3'-AGCTGCATGATGTGAGCAAG-5' 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO IE-1-C RV 3'-TGAGGATAAGCGGGAGATGT-5' 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO IE-1-D FW 5'-CTGAGGCAAGTTCTGCAATG-3' 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO LMP-1 FW 5'-CCAGACAGCAGCCAATTGTC-3' 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO LMP-1 RV 3'-GGTAGAAGACCCCCTCTTAC-5' 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO MGMGT E1F PARA PCR CON SECUENCIA GCGCTCTCTTGCTTTTCTCA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO MGMGT E1R PARA PCR CON SECUENCIA GACACTCACCAAGTCGCAAA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO MGMGT E2F PARA PCR CON SECUENCIA TGGAGCTGTCTGGTTGTGAG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO MGMGT E2R PARA PCR CON SECUENCIA TGGAAAACATGCCGTTATCA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO MGMGT E5F PARA PCR CON SECUENCIA CCGTGAAG-GAATGGCTTCTG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO MGMGT E5R PARA PCR CON SECUENCIA TAGCTCCCGCTCCCTTG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 904, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO P1METHF PARA PCR CON SECUENCIA TTTCGACGTTCGTAGGTTTTCGC", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1224, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO P1UNMETHF PARA PCR CON SECUENCIA TTTGTGTTTTGATGTTTGTAGGTTTTTGT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1543, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO P2METHR PARA PCR CON SECUENCIA CTCGAAACTACCACCGTCCCGA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1170, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO P2METHR PARA PCR CON SECUENCIA GCACTCTTCCGAAAACGAAACG", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1170, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO P2UNMETHR PARA PCR CON SECUENCIA AACTCCACACTCTTCCAAAAACAAAACA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1490, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO ¿-GLOBINA 3´-CAACTTCATCCACGTTCACC-5´ 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "OLIGONUCLEOTIDO ¿-GLOBINA 5´-GAAGAGCCAAGGACAGGTAC-3´ 200 NANOMOLES", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1064, "currency": "MXN" } } }, { "id": "0", "description": "PCR MASTER MIX KIT", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 11068, "currency": "MXN" } } }, { "id": "0", "description": "POLI-L-LISINA EN SOLUCIÓN", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3352, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBO DE 1.5 ML TRANSPARENTE (TUBO TIPO EPENDORF) CAJA C/500", "classification": { "scheme": "CUCOP", "id": "25501-0026", "description": "MICROPIPETAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 176, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBOS DE POLIPROPILENO CÓNICOS DE 1.5 ML DE TAPA PLANA PARA MICROCENTRÍFUGA", "classification": { "scheme": "CUCOP", "id": "25501-0026", "description": "MICROPIPETAS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 176, "currency": "MXN" } } }, { "id": "0", "description": "MICROTUBOS PARA PCR DE 0.2 ML DE TAPA PLANA", "classification": { "scheme": "CUCOP", "id": "25501-0089", "description": "MATERIAL DE VIDRIO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 527, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS AZULES PARA PIPETA AUTOMATICA VOLUMEN 1000 µL (MICROLITROS)", "classification": { "scheme": "CUCOP", "id": "25501-0095", "description": "PUNTAS PARA MICROPIPETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 220, "currency": "MXN" } } }, { "id": "0", "description": "PUNTAS PARA MICROPIPETA DE 0.5 A 10 µL (BLANCAS)", "classification": { "scheme": "CUCOP", "id": "25501-0095", "description": "PUNTAS PARA MICROPIPETA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 219, "currency": "MXN" } } }, { "id": "0", "description": "AGAR DE MUELLER HINTON MEDIO DE CULTIVO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1952.64, "currency": "MXN" } } }, { "id": "0", "description": "GUANTES DE NITRILO,NEGRO, DESECHABLES, AMBIDIESTRO TAMAÑO MEDIANO", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 105, "currency": "MXN" } } }, { "id": "0", "description": "GUANTES DE NITRILO,NEGRO, DESECHABLES, AMBIDIESTROS TAMAÑO CHICO", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 105, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO ACÉTICO GLACIAL PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 342, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO ASCÓRBICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1585, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO CÍTRICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 256, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO FOSFOTUNGSTICOP ARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3159, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO NITRICO 70% GRADO REACTIVO,", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 539, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO PERYÓDICO PARA USO EN LABORATORIO CON PUREZA = 98 % Y LIBRE DE CONTAMINANTES", "classification": { "scheme": "CUCOP", "id": "25101-0011", "description": "FUNCION ACIDO (COMPUESTOS ALIFATICOS)" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1125, "currency": "MXN" } } }, { "id": "0", "description": "AGUA BIDESTILADA", "classification": { "scheme": "CUCOP", "id": "25101-0063", "description": "AGUA BIDESTILADA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 221, "currency": "MXN" } } }, { "id": "0", "description": "AGUA DESIONIZADA", "classification": { "scheme": "CUCOP", "id": "25101-0062", "description": "AGUA DESIONIZADA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 219.5, "currency": "MXN" } } }, { "id": "0", "description": "LACOSAMIDA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 36258, "currency": "MXN" } } }, { "id": "0", "description": "L-ASCORBIC ACID", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1562, "currency": "MXN" } } }, { "id": "0", "description": "DETERGENTE ALCALINO CONCENTRADO (EXTRAN). FRASCO. 4 L.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 391, "currency": "MXN" } } }, { "id": "0", "description": "DETERGENTE DESINFECTANTE NEUTRO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 258, "currency": "MXN" } } }, { "id": "0", "description": "EXTRAN NEUTRO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 243, "currency": "MXN" } } }, { "id": "0", "description": "KIT DE DE TUBERIA Y UNIONES PARA CROMATOGRAFIA COMPATIBLE CON AGILENT Y PERKIN ELMER", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 12589, "currency": "MXN" } } }, { "id": "0", "description": "COLUMNA, AGILENT, ZORBAX ECLIPSE XDB-C18 , 4.6MM X 150 MM X 5 MICROMETROS DE PARTÍCULA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 12896, "currency": "MXN" } } }, { "id": "0", "description": "COLUMNA, AGILENT, ZORBAX SB-C18 , 4.6MM X 150 MM X 5 MICROMETROS DE PARTÍCULA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 9987, "currency": "MXN" } } }, { "id": "0", "description": "CONECTOR PARA TUBERÍA PEEK", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1285, "currency": "MXN" } } }, { "id": "0", "description": "ECLIPSE PLUS C18, COLUMNA ANALÍTIA", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 12999, "currency": "MXN" } } }, { "id": "0", "description": "PIPETAS SEROLOGICAS DE 10 ML ESTERIL FABRICADO DE POLIESTIRENO 100% VIRGEN ULTRA TRANSPARENTE P/MÁX IMA CLARIDAD, EMPAQUE INDIVIDUAL, LIBRE DE RNASA/DNASA, ADN HUMANO, NO CITOTÓX ICO, NO PIROGÉNICO, CAJA CON 200,", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1905, "currency": "MXN" } } }, { "id": "0", "description": "TUBERÍA PEEK", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 1105, "currency": "MXN" } } }, { "id": "0", "description": "UNIDADES DE FILTRADO (FILTRO PIRINOLA) HIDROFÍLICAS DE PTFE, 0.45 MICRAS DE PORO Y 13 MM DE DIÁMETRO, CAJA CON 100 PIEZAS", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 3698, "currency": "MXN" } } }, { "id": "0", "description": "FILTRO DE JERINGA DIÁMETRO: 25 MM, TAMAÑO DEL PORO: 0,45 UM,", "classification": { "scheme": "CUCOP", "id": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "unit": { "name": "PIEZA", "value": { "amount": 2979, "currency": "MXN" } } }, { "id": "0", "description": "GLUCOSA", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 296, "currency": "MXN" } } }, { "id": "0", "description": "BICARBONATO DE SODIO GRADO ACS FRASCO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 261, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO TRICLOROACÉTICO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1709, "currency": "MXN" } } }, { "id": "0", "description": "CARBONATO DE SODIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1559, "currency": "MXN" } } }, { "id": "0", "description": "ACETATO DE ZINC", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1688.6, "currency": "MXN" } } }, { "id": "0", "description": "NITRATO DE SODIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 459, "currency": "MXN" } } }, { "id": "0", "description": "SULFATO FERROSO AMONIACAL GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 568, "currency": "MXN" } } }, { "id": "0", "description": "PERSULFATO DE AMONIO GRADO REACTIVO ACS =99.0%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 279, "currency": "MXN" } } }, { "id": "0", "description": "FOSFATO DE SODIO MONOBÁSICO MONOHIDRATADO NAH2PO4. H2O GRADO ACS", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 299, "currency": "MXN" } } }, { "id": "0", "description": "AZUL TRIPANO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 510, "currency": "MXN" } } }, { "id": "0", "description": "METANOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 309, "currency": "MXN" } } }, { "id": "0", "description": "ALCOHOL ETILICO ABSOLUTO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 211, "currency": "MXN" } } }, { "id": "0", "description": "ETANOL ABSOLUTO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 585.4, "currency": "MXN" } } }, { "id": "0", "description": "ÉTER ETÍLICO ANHIDRO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2247.5, "currency": "MXN" } } }, { "id": "0", "description": "METANOL GRADO HPLC", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 339, "currency": "MXN" } } }, { "id": "0", "description": "METANOL GRADO HPLC. FCO. 4 L.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 339, "currency": "MXN" } } }, { "id": "0", "description": "PERÓXIDO DE HIDRÓGENO AL 30%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 139, "currency": "MXN" } } }, { "id": "0", "description": "XILOL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3100.2, "currency": "MXN" } } }, { "id": "0", "description": "ACIDO ACETICO (JT BAKER)", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 489, "currency": "MXN" } } }, { "id": "0", "description": "ÁCIDO NITRICO 68-70% CONCENTRACION.", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 469, "currency": "MXN" } } }, { "id": "0", "description": "AGUA BIDESTILADA", "classification": { "scheme": "CUCOP", "id": "25101-0063", "description": "AGUA BIDESTILADA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 217, "currency": "MXN" } } }, { "id": "0", "description": "AGUA DESIONIZADA", "classification": { "scheme": "CUCOP", "id": "25101-0062", "description": "AGUA DESIONIZADA" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 231, "currency": "MXN" } } }, { "id": "0", "description": "DEXTROSA EN POLVO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 298, "currency": "MXN" } } }, { "id": "0", "description": "DEXTROSOL SOLUCION GLUCOSADA 75 G EN 250 ML. SE SUGIERE HYCEL", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 3206.4, "currency": "MXN" } } }, { "id": "0", "description": "ETANOL ABSOLUTO", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 2873.1, "currency": "MXN" } } }, { "id": "0", "description": "ETANOL AL 96%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 1170, "currency": "MXN" } } }, { "id": "0", "description": "PERÓXIDO DE HIDRÓGENO AL 30%", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 186, "currency": "MXN" } } }, { "id": "0", "description": "TINCION EA50 PARA PAPANICOLAOU LISTA PARA USARSE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 315, "currency": "MXN" } } }, { "id": "0", "description": "TINCION OG-6 PARA PAPANICOLAOU LISTA PARA USARSE", "classification": { "scheme": "CUCOP", "id": "25101-0037", "description": "REACTIVOS ANALITICOS" }, "additionalClassifications": [ { "scheme": "CUCOP-partida", "id": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" } ], "unit": { "name": "PIEZA", "value": { "amount": 225, "currency": "MXN" } } } ], "documents": [ { "id": "1", "title": "CONVOCATORIA SUSTANCIAS VF 1 VERSION FINAL.docx", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:02:17.060Z" }, { "id": "2", "title": "ANEXO SUSTANCIAS REACTIVOS Y MAT LABORATORIO.docx", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:02:14.203Z" }, { "id": "3", "title": "MODELO DE CONTRATO.docx", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:02:15.505Z" }, { "id": "4", "title": "Junta de aclaraciones I-8 Sustancias quimicas.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:02:25.265Z" }, { "id": "5", "title": "AVISO DE DIFERIMIENTO DE APERTURA DE PROPUESTAS Y ACTO DE FALLO SUSTANCIAS QUIMICAS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:02:26.502Z" }, { "id": "6", "title": "ACTA APERTURA DE PROPUESTAS SUSTANCIAS QUÍMICAS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:02:39.946Z" }, { "id": "7", "title": "DIFERIMIENTO FALLO SUSTANCIAS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:02:44.873Z" }, { "id": "8", "title": "DIFERIMIENTO FALLO SUSTANCIAS 2.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:02:47.857Z" }, { "id": "9", "title": "ACTA DIFERIMIENTO SUSTANCIAS 3.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:02:50.473Z" }, { "id": "10", "title": "ACTA DIFERIMIENTO SUSTANCIAS 3.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:02:56.304Z" }, { "id": "11", "title": "ACTA FALLO SUSTANCIAS VF.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:03:06.090Z" }, { "id": "12", "title": "ANEXOS SUSTANCIAS.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:03:27.005Z" }, { "id": "13", "title": "ANEXO 3.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:03:35.045Z" }, { "id": "14", "title": "Acta rectificación de fallo Sustancias.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:03:42.354Z" }, { "id": "15", "title": "Acta rectificación de fallo Sustancias.pdf", "url": "https://comprasmx.buengobierno.gob.mx/sitiopublico/#/sitiopublico/detalle/f25eab7ab1774beb9b18f1576f9345ae/procedimiento", "documentType": "biddingDocuments", "datePublished": "2025-12-04T08:03:44.648Z" } ] }, "awards": [ { "id": "1", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "BRI BIORESEARCH SA DE CV", "name": "BRI BIORESEARCH SA DE CV" } ], "value": { "amount": 310300, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "2", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "ABALAT SA DE CV", "name": "ABALAT SA DE CV" } ], "value": { "amount": 226239.44, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "3", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "ABYNTECH SA DE CV", "name": "ABYNTECH SA DE CV" } ], "value": { "amount": 8549418.72, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "4", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "name": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV" } ], "value": { "amount": 650985.97, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "5", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "BECTON DICKINSON DE MEXICO SA DE CV", "name": "BECTON DICKINSON DE MEXICO SA DE CV" } ], "value": { "amount": 110188.4, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "6", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "BOVINE & BIOLOGY SA DE CV", "name": "BOVINE & BIOLOGY SA DE CV" } ], "value": { "amount": 306328.16, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "7", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "BRENDA PAOLA CUELLAR RIVERA", "name": "BRENDA PAOLA CUELLAR RIVERA" } ], "value": { "amount": 1057848.82, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2024-12-31T06:00:00.000Z" } }, { "id": "8", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "CIENTIFICA SENNA SA DE CV", "name": "CIENTIFICA SENNA SA DE CV" } ], "value": { "amount": 962444.92, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "9", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "COMERCIAL BIOMEDICO JR SA DE CV", "name": "COMERCIAL BIOMEDICO JR SA DE CV" } ], "value": { "amount": 117856.95, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "10", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV", "name": "COMERCIALIZADORA E IMPORTADORA DE PRODUCTOS QUIMICOS SA DE CV" } ], "value": { "amount": 938681.28, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "11", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "COMPAÑIA VILAB SA DE CV", "name": "COMPAÑIA VILAB SA DE CV" } ], "value": { "amount": 838814.56, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "12", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "name": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV" } ], "value": { "amount": 838599.96, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "13", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "CORPORATIVO FARMACEUTICO GEPHAM SA DE CV", "name": "CORPORATIVO FARMACEUTICO GEPHAM SA DE CV" } ], "value": { "amount": 609203.22, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "14", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "DIAGNOCELL LABORATORIOS SA DE CV", "name": "DIAGNOCELL LABORATORIOS SA DE CV" } ], "value": { "amount": 350546.05, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "15", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "DISTRIBUIDORA BIOGAMA SA DE CV", "name": "DISTRIBUIDORA BIOGAMA SA DE CV" } ], "value": { "amount": 21373, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "16", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "EQUIVER SA DE CV", "name": "EQUIVER SA DE CV" } ], "value": { "amount": 89492.93, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "17", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "JRL SUPPLIERS S DE RL DE CV", "name": "JRL SUPPLIERS S DE RL DE CV" } ], "value": { "amount": 386056.96, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "18", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "MAYIMEX SA DE CV", "name": "MAYIMEX SA DE CV" } ], "value": { "amount": 8816, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "19", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "PEGO MEDICAL SA DE CV", "name": "PEGO MEDICAL SA DE CV" } ], "value": { "amount": 29399.04, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "20", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "QUIMICA VALANER SA DE CV", "name": "QUIMICA VALANER SA DE CV" } ], "value": { "amount": 37135.08, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "21", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "REACTIVOS Y MARCAS DE MEXICO SA DE CV", "name": "REACTIVOS Y MARCAS DE MEXICO SA DE CV" } ], "value": { "amount": 494407.45, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "22", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "SILVERA CIENCIA E INGENIERIA SA DE CV", "name": "SILVERA CIENCIA E INGENIERIA SA DE CV" } ], "value": { "amount": 1752927.04, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "23", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "SOLUCIONES MEDICAS DIGITALES URBA SA DE CV", "name": "SOLUCIONES MEDICAS DIGITALES URBA SA DE CV" } ], "value": { "amount": 2265.06, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "24", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "TECNOLOGIA MEDICA DIART SA DE CV", "name": "TECNOLOGIA MEDICA DIART SA DE CV" } ], "value": { "amount": 20097, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } }, { "id": "25", "status": "active", "date": "2023-11-13T15:30:00.000Z", "suppliers": [ { "id": "TECROM SA DE CV", "name": "TECROM SA DE CV" } ], "value": { "amount": 863976.01, "currency": "MXN" }, "contractPeriod": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" } } ], "contracts": [ { "id": "C-2023-00152122", "awardID": "1", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 310300, "currency": "MXN" } }, { "id": "C-2023-00151441", "awardID": "2", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 226239.44, "currency": "MXN" } }, { "id": "C-2023-00153001", "awardID": "3", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 8549418.72, "currency": "MXN" } }, { "id": "C-2023-00151510", "awardID": "4", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 650985.97, "currency": "MXN" } }, { "id": "C-2023-00151525", "awardID": "5", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 110188.4, "currency": "MXN" } }, { "id": "C-2023-00152106", "awardID": "6", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 306328.16, "currency": "MXN" } }, { "id": "C-2023-00152112", "awardID": "7", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2024-12-31T06:00:00.000Z" }, "value": { "amount": 1057848.82, "currency": "MXN" } }, { "id": "C-2023-00152143", "awardID": "8", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 962444.92, "currency": "MXN" } }, { "id": "C-2023-00152145", "awardID": "9", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 117856.95, "currency": "MXN" } }, { "id": "C-2023-00153011", "awardID": "10", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 938681.28, "currency": "MXN" } }, { "id": "C-2023-00152124", "awardID": "11", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 838814.56, "currency": "MXN" } }, { "id": "C-2023-00153036", "awardID": "12", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 838599.96, "currency": "MXN" } }, { "id": "C-2023-00152105", "awardID": "13", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 609203.22, "currency": "MXN" } }, { "id": "C-2023-00152102", "awardID": "14", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 350546.05, "currency": "MXN" } }, { "id": "C-2023-00152097", "awardID": "15", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 21373, "currency": "MXN" } }, { "id": "C-2023-00152095", "awardID": "16", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 89492.93, "currency": "MXN" } }, { "id": "C-2023-00152088", "awardID": "17", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 386056.96, "currency": "MXN" } }, { "id": "C-2023-00152079", "awardID": "18", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 8816, "currency": "MXN" } }, { "id": "C-2023-00152072", "awardID": "19", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 29399.04, "currency": "MXN" } }, { "id": "C-2023-00152064", "awardID": "20", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 37135.08, "currency": "MXN" } }, { "id": "C-2023-00152060", "awardID": "21", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 494407.45, "currency": "MXN" } }, { "id": "C-2023-00151766", "awardID": "22", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 1752927.04, "currency": "MXN" } }, { "id": "C-2023-00151608", "awardID": "23", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 2265.06, "currency": "MXN" } }, { "id": "C-2023-00151588", "awardID": "24", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 20097, "currency": "MXN" } }, { "id": "C-2023-00151548", "awardID": "25", "status": "active", "title": "LICITACIÓN PARA LA ADQUISICIÓN DE SUSTANCIAS QUÍMICAS, REACTIVOS Y MAT. LAB.", "period": { "startDate": "2023-11-14T06:00:00.000Z", "endDate": "2023-12-31T06:00:00.000Z" }, "value": { "amount": 863976.01, "currency": "MXN" } } ], "extensions": { "source": "ComprasMX", "canonical": "https://postor.com.mx/licitacion/la-12-nck-012nck001-i-8-2023", "license": "https://creativecommons.org/licenses/by/4.0/", "ocidPrefixRegistered": false } }