{ "html_url": "https://postor.com.mx/adjudicacion/aa-12-ncd-012ncd001-i-151-2025", "canonical": "https://postor.com.mx/adjudicacion/aa-12-ncd-012ncd001-i-151-2025", "id": "9695c100b9d945b3a06df98180a72194", "procedure_number": "AA-12-NCD-012NCD001-I-151-2025", "file_number": "E-2025-00056027", "title": "INSUMOS P/ LA REALIZACIÓN DE PRUEBAS DE CUANTIFICACIÓN DE CARGA VIRAL CIENI", "description": { "short": "Adquisiciones, arrendamientos y servicios, dentro de los montos máximos establecidos en el PEF.", "detailed": "BIGDYE TERMINATOR V1.1 & V3.1 5X SEQUENCING BUFFER 1 ML, PIEZA, MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4336697\nBIGDYE TERMINATOR V3.1 CYCLE SEQUENCING KIT 100 REACTIONS, PIEZA, MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4337455\nSUPERSCRIPT III ONE-STEP RT-PCR SYSTEM WITH PLATINUM TAQ DNA POLYMERASE 100 REACTIONS, MARCA INVITROGEN, CATÁLOGO 12574026\nQIAAMP VIRAL RNA MINI KIT (250)MARCA QIAGEN CAT. 52906\nEDTA (0.5 M), PH 8.0, RNASE-FREE 100 ML, PIEZA, MARCA INVITROGEN, CATÁLOGO AM9260G\nGELRED NUCLEIC ACID GEL STAIN, 10,000X IN WATER 0.5 ML, PIEZA, MARCA BIOTIUM, CATÁLOGO 41003\nQIAQUICK PCR PURIFICATION KIT (250 PRUEBAS). MARCA QIAGEN CAT. 28106 PIEZA\nETHYL ALCOHOL, PURE =99.45%, FOR MOLECULAR BIOLOGY, 200 PROOF, SUITABLE FOR RNA EXTRACTION AND DNA EXTRACTION, 1 L, PIEZA, MARCA SIGMA ALDRICH, CATÁLOGO E7023-1L\nCERTIFIED MOLECULAR BIOLOGY AGAROSE 500G, PIEZA, MARCA BIO RAD (LIFE SCIENCE), CATÁLOGO 1613102 \nMICROCENTRIFUGE TUBE 1.5 ML, PP, 5 COLORS, CAJA CON 5,000 PIEZAS, MARCA SPL LIFE SCIENCES, CATÁLOGO 61015\nPLATINUM TAQ DNA POLYMERASE 600 REACTIONS, PIEZA, MARCA INVITROGEN, CATÁLOGO 10966034\nTUBOS PCR DE PARED FINA DE 0,2 ML CON TAPA PLANA, COLORES SURTIDOS, NO ESTÉRILES\nMICROAMP OPTICAL 96-WELL REACTION PLATE 500 PLATES, PIEZA, MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4316813\nDEOXYNUCLEOSIDE TRIPHOSPHATE SET, PCR GRADE, MARCA ROCHE, CATÁLOGO 11969064001\nBORIC ACID SUITABLE FOR ELECTROPHORESIS, =99.5%, 1 KG, PIEZA, MARCA SIGMA ALDRICH, CATÁLOGO B7901-1KG\nTRIS REACTIVO PARA ELECTROFORESIS, BOTE DE 1 KG, MARCA BIO RAD (LIFE SCIENCES), CÁTALOGO 1610719\nAXYGEN 10 ¿L MAXYMUM RECOVERY PIPET TIPS, FILTERED, CLEAR, STERILE, LONG LENGTH, CAJA CON 50 RACK DE 96 PUNTAS, MARCA CORNING, CATÁLOGO TXLF-10-L-R-S\nAXYGEN 100 ¿L MAXYMUM RECOVERY UNIVERSAL FIT FILTER TIPS, CLEAR, STERILE, CAJA CON 50 RACK DE 96 PUNTAS, MARCA CORNING, CATÁLOGO TF-100-L-R-S\nAXYGEN 200 ¿L MAXYMUM RECOVERY UNIVERSAL FIT FILTER TIPS, CLEAR, CAJA CON 50 RACK DE 96 PUNTAS, MARCA CORNING, CATÁLOGO TF-200-L-R-S\nPOP-7 POLYMER FOR" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO PARCIAL", "moved_at": null }, "buyer": { "agency": "INER", "acronym": "INER", "branch": "12 - SALUD", "buying_unit": "DEPARTAMENTO DE ADQUISICIONES", "requesting_unit": null, "requesting_group": "DEPARTAMENTO DE ADQUISICIONES", "entity": "INSTITUTO NACIONAL DE ENFERMEDADES RESPIRATORIAS ISMAEL COSIO VILLEGAS", "slug": "iner", "unit_slug": "departamento-de-adquisiciones-012ncd001" }, "classification": { "procedure_type": "ADJUDICACIÓN DIRECTA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "INTERNACIONAL ABIERTO", "fiscal_year": 2025, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": "191", "exception_basis": "Art. 55 párrafo primero", "internal_control_number": "2025033439", "supply_source_number": null }, "schedule": { "published_at": "2025-06-25T02:35:37.000Z", "clarification_meeting_at": null, "clarification_questions_deadline_at": null, "clarification_responses_deadline_at": null, "bid_opening_at": "2025-06-27T20:00:00.000Z", "award_at": null, "estimated_contract_at": "2025-07-18T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "locations": { "state_id": "7", "state": "CIUDAD DE MÉXICO", "bid_opening": null, "award": null, "clarification_meeting": null, "site_visit": null, "work_site": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "financial_terms": { "currency": "MXN", "advance_percentage": "0", "supplier_percentage": "10", "payment_method": "DENTRO DE LOS 17 DÍAS NATURALES POSTERIORES A LA PRESENTACIÓN DE LA FACTURA", "credit_condition": null, "payment_conditions": null, "financing_organization": null }, "evaluation": { "criterion": "BINARIO", "technical_points": null, "economic_points": null }, "guarantees": { "performance_required": true, "goods_or_services_required": false, "amount_percentage": null, "delivery_days": "10", "term_months": null, "other_insurance_required": false, "other_insurance_description": null, "performance_reduction": null }, "participation": { "method": null, "joint": false, "msme_only": false, "social_witness": false, "multi_year": false, "open_contract": false, "consolidated_purchase": false, "external_credit": false, "simultaneous_supply": false, "subcontracting": null, "emergency": false, "proposal_language": "idioma data", "no_joint_participation_justification": null }, "execution": { "site_visit_required": false, "duration_days": null, "procurement_term": "Normal", "subcontracted_work": null, "deadline_justification": null }, "lots": [ { "number": "1", "name": "PARTIDA SOLA", "description": "PARTIDA SOLA", "requirement_group_id": "1", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BIGDYE TERMINATOR V1.1 & V3.1 5X SEQUENCING BUFFER 1 ML, PIEZA, (SE SUGIERE MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4336697)", "requested_quantity": "12", "minimum_quantity": "12", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "2", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BIGDYE TERMINATOR V3.1 CYCLE SEQUENCING KIT 100 REACTIONS, PIEZA\n( SE SUGIERE MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4337455)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SUPERSCRIPT III ONE-STEP RT-PCR SYSTEM WITH PLATINUM TAQ DNA POLYMERASE 100 REACTIONS \n(SE SUGIERE MARCA INVITROGEN, CATÁLOGO 12574026)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "4", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QIAAMP VIRAL RNA MINI KIT (250)\n(SE SUGIERE MARCA QIAGEN CAT. 52906)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EDTA (0.5 M), PH 8.0, RNASE-FREE 100 ML, PIEZA \n(SE SUGIERE MARCA INVITROGEN, CATÁLOGO AM9260G)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "6", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GELRED NUCLEIC ACID GEL STAIN, 10,000X IN WATER 0.5 ML, PIEZA, (SE SUGIERE MARCA BIOTIUM, CATÁLOGO 41003)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "7", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QIAQUICK PCR PURIFICATION KIT (250 PRUEBAS) \n(SE SUGIERE MARCA QIAGEN CAT. 28106 PIEZA)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "8", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETHYL ALCOHOL, PURE =99.45%, FOR MOLECULAR BIOLOGY, 200 PROOF, SUITABLE FOR RNA EXTRACTION AND DNA EXTRACTION, 1 L, PIEZA \n(SE SUGIERE MARCA SIGMA ALDRICH, CATÁLOGO E7023-1L)", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "9", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CERTIFIED MOLECULAR BIOLOGY AGAROSE 500G, PIEZA (SE SSUGIERE MARCA BIO RAD (LIFE SCIENCE), CATÁLOGO 1613102 )", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "10", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MICROCENTRIFUGE TUBE 1.5 ML, PP, 5 COLORS, CAJA CON 5,000 PIEZAS, (SE SUGIERE MARCA SPL LIFE SCIENCES, CATÁLOGO 61015)", "requested_quantity": "5000", "minimum_quantity": "5000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "11", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PLATINUM TAQ DNA POLYMERASE 600 REACTIONS, PIEZA, \n(SE SUGIERE MARCA INVITROGEN, CATÁLOGO 10966034)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TUBOS PCR DE PARED FINA DE 0,2 ML CON TAPA PLANA, COLORES SURTIDOS, NO ESTÉRILES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MICROAMP OPTICAL 96-WELL REACTION PLATE 500 PLATES, PIEZA,\n (SE SUGIERE MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4316813)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DEOXYNUCLEOSIDE TRIPHOSPHATE SET, PCR GRADE, \n(SE SUGIERE MARCA ROCHE, CATÁLOGO 11969064001)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BORIC ACID SUITABLE FOR ELECTROPHORESIS, =99.5%, 1 KG, PIEZA, \n(SE SUGIERE MARCA SIGMA ALDRICH, CATÁLOGO B7901-1KG)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "16", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIS REACTIVO PARA ELECTROFORESIS, BOTE DE 1 KG, \n(SE SUGIERE MARCA BIO RAD (LIFE SCIENCES), CÁTALOGO 1610719)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AXYGEN 10 µL MAXYMUM RECOVERY PIPET TIPS, FILTERED, CLEAR, STERILE, LONG LENGTH, CAJA CON 50 RACK DE 96 PUNTAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO TXLF-10-L-R-S)", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "18", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AXYGEN 100 µL MAXYMUM RECOVERY UNIVERSAL FIT FILTER TIPS, CLEAR, STERILE, CAJA CON 50 RACK DE 96 PUNTAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO TF-100-L-R-S)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "19", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AXYGEN 200 µL MAXYMUM RECOVERY UNIVERSAL FIT FILTER TIPS, CLEAR, CAJA CON 50 RACK DE 96 PUNTAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO TF-200-L-R-S)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POP-7 POLYMER FOR 3730/3730XL DNA ANALYZERS, 1 X 28 ML, PIEZA, (SE SUGIERE MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4363929)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AXYGEN 1000 µL MAXYMUM RECOVERY UNIVERSAL FIT FILTERTIPS, CLEAR, STERILE, CAJA CON 50 RACKS DE 100 PUNTAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO TF-1000-L-R-S)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AXYGEN 20 µL MAXYMUM RECOVERY UNIVERSAL FIT FILTER TIPS RACKED, CLEAR, STERILE, CAJA CON 50 RACK DE 96 PUNTAS,\n(SE SUGIERE MARCA CORNING, CATÁLOGO TF-20-L-R-S)", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "23", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FG, HI-DI FORMAMIDE 25 ML BOTTLE, \n(SE SUGIERE MARCA APPLIED BIOSYSTEMS (CAT: 4311320))", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "24", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "E-GEL 96 HIGH RANGE DNA MARKER 100 APLICACIONES,\n(SE SUGIERE MARCHA INVITROGEN (CAT: 12352-019))", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "25", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "3730 RUNNING BUFFER 10 X 500 ML, \n(SE SUGIERE MARCA APPLIED BIOSYSTEMS (CAT: 4335613))", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "26", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MICROAMP 96-WELL FULL PLATE COVER, \n(SE SUGIERE MARCA THERMO FISHER (CAT: N8010550))", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "27", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PLATE SEPTA 96 WELL 20 PZAS, \n(SE SUGIERE MARCA APPIED BIOSYSTEMS (CAT: 4315933))", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "28", "cucop_code": "25401-1097", "specific_item_code": "25401", "cucop_description": "060.066.0773 ANTISEPTICOS. ALCOHOL DESNATURALIZADO. ENVASE CON 20 LTS.", "description": "ANTISEPTICOS. ALCOHOL DESNATURALIZADO. ENVASE CON 20 LITROS", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "29", "cucop_code": "25401-8702", "specific_item_code": "25401", "cucop_description": "060.436.0701 GASAS. SECA CORTADA, DE ALGODÓN, DE DOCE CAPAS; CON TEJIDO TIPO III. ANCHO: 10 CM. ESTÉRIL Y DESECHABLE. ENVASE CON DOS Y CINCO PIEZAS.", "description": "GASAS. SECA CORTADA DE ALGODÓN CON MARCA RADIOPACA. LARGO: 10 CM. ANCHO: 10 CM. ENVASE CON 200 PIEZAS.", "requested_quantity": "150", "minimum_quantity": "150", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "30", "cucop_code": "25401-0015", "specific_item_code": "25401", "cucop_description": "AGUJA HIPODERMICA", "description": "AGUJA HIPODÉRMICA PARA TOMA MÚLTIPLE CON BROCHE DE SEGURIDAD, CALIBRE 21G X 32MM.", "requested_quantity": "119476", "minimum_quantity": "119476", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "31", "cucop_code": "25401-0015", "specific_item_code": "25401", "cucop_description": "AGUJA HIPODERMICA", "description": "HOLDER CON BOTÓN AUTOMÁTICO DE EXPULSIÓN DE LA AGUJA O SOPORTE.", "requested_quantity": "2582", "minimum_quantity": "2582", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "32", "cucop_code": "25401-0023", "specific_item_code": "25401", "cucop_description": "AGUJA PARA PUNCION DE VASOS", "description": "EQUIPO ALADO TIPO MARIPOSA PARA RECOLECCIÓN DE SANGRE VENOSA, PUSH-BUTTON, COLOR AZUL, 25G X 19MM X 178MM", "requested_quantity": "416", "minimum_quantity": "416", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "33", "cucop_code": "25401-0046", "specific_item_code": "25401", "cucop_description": "BANDA ADHESIVA", "description": "BANDITA ADHESIVA REDONDA CON APÓSITO CENTRAL DE ACRÍLICO, HIPOALERGÉNICA DE ±22 MM DE DIÁMETRO, COLOR PIEL.", "requested_quantity": "44836", "minimum_quantity": "44836", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "34", "cucop_code": "25401-0244", "specific_item_code": "25401", "cucop_description": "GUANTES PARA EXPLORACION", "description": "GUANTE DE NITRILO, SIN LÁTEX, SIN POLVO, DEDOS TEXTURIZADOS, PUÑO CON REBORDE, NO ESTÉRIL Y AMBIDIESTRO, TALLA EXTRA CHICA, PIEZA", "requested_quantity": "168", "minimum_quantity": "168", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "35", "cucop_code": "25401-0244", "specific_item_code": "25401", "cucop_description": "GUANTES PARA EXPLORACION", "description": "GUANTE DE NITRILO, SIN LÁTEX, SIN POLVO, DEDOS TEXTURIZADOS, PUÑO CON REBORDE, NO ESTÉRIL Y AMBIDIESTRO, TALLA CHICA, PIEZA", "requested_quantity": "1008", "minimum_quantity": "1008", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "36", "cucop_code": "25401-0244", "specific_item_code": "25401", "cucop_description": "GUANTES PARA EXPLORACION", "description": "GUANTE DE NITRILO, SIN LÁTEX, SIN POLVO, DEDOS TEXTURIZADOS, PUÑO CON REBORDE, NO ESTÉRIL Y AMBIDIESTRO, TALLA MEDIANA, PIEZA", "requested_quantity": "504", "minimum_quantity": "504", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "37", "cucop_code": "25401-0244", "specific_item_code": "25401", "cucop_description": "GUANTES PARA EXPLORACION", "description": "GUANTE DE NITRILO, SIN LÁTEX, SIN POLVO, DEDOS TEXTURIZADOS, PUÑO CON REBORDE, NO ESTÉRIL Y AMBIDIESTRO, TALLA GRANDE, PIEZA", "requested_quantity": "168", "minimum_quantity": "168", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "38", "cucop_code": "25401-0505", "specific_item_code": "25401", "cucop_description": "TORUNDA ALGODON", "description": "TOALLITAS ANTISÉPTICAS INDIVIDUALES IMPREGNADAS CON ALCOHOL ISOPROPÍLICO AL 70% PARA LIMPIEZA PREVIA A LA PUNCIÓN.", "requested_quantity": "181436", "minimum_quantity": "181436", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "39", "cucop_code": "25401-8158", "specific_item_code": "25401", "cucop_description": "TORNIQUETE MÉDICO", "description": "TORNIQUETE DE LIBERACIÓN AUTOMÁTICA REUTILIZABLE.", "requested_quantity": "200", "minimum_quantity": "200", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "40", "cucop_code": "25401-8164", "specific_item_code": "25401", "cucop_description": "060.621.0656 CUBREBOCAS QUIRÚRGICO ELABORADO CON DOS CAPAS EXTERNAS DE TELA NO TEJIDA, UN FILTRO INTERMEDIO DE POLIPROPILENO; PLANO O PLISADO; CON AJUSTE NASAL MOLDEABLE. RESISTENTE A FLUIDOS, ANTIESTÁTICO, HIPOALERGÉNICO. CON BANDAS O AJUSTE ELÁSTICO ENTORCHADO A LA CABEZA O RETROAURICULAR", "description": "CUBREBOCAS QUIRÚRGICO. CUBREBOCA QUIRÚRGICO ELABORADO CON DOS CAPAS EXTERNAS DE TELA NO TEJIDA UN FILTRO INTERMEDIO DE POLIPROPILENO; PLANO O PLISADO; CON AJUSTE NASAL MOLDEABLE. RESISTENTE A FLUIDOS ANTIESTÁTICO HIPOALERGÉNICO. CON BANDAS O AJUSTE ELÁSTICO ENTORCHADO A LA CABEZA O RETROAURICULAR. DESECHABLE. PIEZA.", "requested_quantity": "6120", "minimum_quantity": "6120", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "41", "cucop_code": "25401-8677", "specific_item_code": "25401", "cucop_description": "060.231.0641 BATAS QUIRÚRGICAS", "description": "BATA QUIRÚRGICA CON PUÑOS AJUSTABLES Y REFUERZO EN MANGAS Y PECHO. TELA NO TEJIDA DE POLIPROPILENO IMPERMEABLE A LA PENETRACIÓN DE LÍQUIDOS Y FLUIDOS ; ANTIESTÁTICA Y RESISTENTE A LA TENSIÓN. ESTÉRIL Y DESECHABLE. TAMAÑO: GRANDE PIEZA.", "requested_quantity": "820", "minimum_quantity": "820", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "42", "cucop_code": "25401-8006", "specific_item_code": "25401", "cucop_description": "080.909.0137 TUBOS PARA LA TOMA Y RECOLECCION DE SANGRE. DE VIDRIO AL VACIO (13 X 75 MM) DESECHABLE PARA ADULTO CON EDTA TRIPOTASICO (0.048 ML) LIQUIDO TAPON LILA CON SILICON COMO LUBRICANTE VOLUMEN DE DRENADO 4.8-4.9 ML (± 0.3 ML) EL RANGO MENOR ESTABLECE EL VOLUMEN DE DRENADO A LA ALTURA DEL ALTIPLANO MEXICANO Y EL RANGO MAYOR AL NIVEL DEL MAR. ETIQUETADOS INDIVIDUALMENTE CON NUMERO DE LOTE Y FECHA DE CADUCIDAD. CON O SIN TAPON DE SEGURIDAD. CAJA CON 100.", "description": "TUBO DE PLÁSTICO CON ANTICOAGULANTE EDTA PARA ANÁLISIS DE SANGRE TOTAL Y/O PLASMA. TAMAÑO 13X75 MM. 4 ML DE CAPACIDAD.", "requested_quantity": "111576", "minimum_quantity": "111576", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "43", "cucop_code": "25401-8005", "specific_item_code": "25401", "cucop_description": "080.909.0129 TUBOS PARA LA TOMA Y RECOLECCION DE SANGRE. DE VIDRIO AL VACIO (13 X 100 MM) DESECHABLE PARA ADULTO CON EDTA DISODICO (10.5 MG) TAPON LILA CON SILICON COMO LUBRICANTE VOLUMEN DE DRENADO 6.7-7 ML (± 0.3 ML) EL RANGO MENOR ESTABLECE EL VOLUMEN DE DRENADO A LA ALTURA DEL ALTIPLANO MEXICANO Y EL RANGO MAYOR A NIVEL DEL MAR. ETIQUETADOS INDIVIDUALMENTE CON NUMERO DE LOTE Y FECHA DE CADUCIDAD. CON O SIN TAPON DE SEGURIDAD. CAJA CON 100.", "description": "TUBO DE PLÁSTICO CON ANTICOAGULANTE EDTA PARA ANÁLISIS DE SANGRE TOTAL Y/O PLASMA. TAMAÑO 13X100 MM. 6 ML DE CAPACIDAD", "requested_quantity": "229672", "minimum_quantity": "229672", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "44", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "VIAL CRIOGÉNICO DE POLIPROPILENO CON ROSCA INTERNA DE 4 ML, AUTOPORTANTE Y FONDO REDONDO", "requested_quantity": "3553", "minimum_quantity": "3553", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "45", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "TUBO DE PLÁSTICO CON ANTICOAGULANTE EDTA PARA ANÁLISIS DE SANGRE TOTAL Y/O PLASMA. VOLUMEN DE RECOLECCIÓN DE 250 – 500 µL", "requested_quantity": "5000", "minimum_quantity": "5000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "46", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "COLLECTION TUBES (2ML) \n(SE SUGIERE MARCA QIAGEN 1000 CAT. 19201)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SET DE PRIMERS:\nPR 5’ OUTER / CCCCTAGGAAAAAGGGCTGTTG / 22 BASES / 200 NMOL / DST \nRT 3’ OUTER / GTTTTCAGATTTTTAAATGGCTCTTG / 26 BASES / 200 NMOL / DST \nPR 5’ INNER / TGAAAGATTGTACTGAGAGACAGG / 24 BASES / 200 NMOL / DST \nRT 3’ INNER / GGCTCTTGATAAATTTGATATGTCC / 25 BASES / 200 NMOL / DST \nPOL_A / CCAGAAGAGAGCTTCAGGTCTGGGG / 25 BASES / 200 NMOL / DST \nPOL_B / GTTAAACAATGGCCATTGACAGAAG / 25 BASES / 200 NMOL / DST \nPOL_C / GGAAAGGATCACCAGCAATATTCCA / 25 BASES / 200 NMOL / DST \nPOL_D / CCCTCARATCACTCTTTGGCAACG / 24 BASES / 200 NMOL / DST \nPOL_F / CTTTTGGGCCATCCATTCCTGGCTT / 25 BASES / 200 NMOL / DST \nPOL_G / CCATCCCTGTGGAAGCACATTGTA / 24 BASES / 200 NMOL / DST \nPOL_H / TGCCCCTGCTTCTGTATTTCTGCTA / 25 BASES / 200 NMOL / DST\n\n(SE SUGIERE MARCA (T4 OLIGO))", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "48", "cucop_code": "25401-6574", "specific_item_code": "25401", "cucop_description": "080.709.0360 PIPETAS PIPETA SEROLOGICA DE PLASTICO ESTERIL LIBRE DE PIROGENOS DESECHABLE CON TAPON DE SEGURIDAD (ALGODON) EN EMPAQUE INDIVIDUAL. PARA PIPETOR AUTOMATICO. PARA VOLUMENES: 5 ML. GRADUACION. 5 ML EN 1/10 CAJA CON 200 PIEZAS.", "description": "PIPETA SEROLÓGICA DE 5 ML, COLOR AZUL, ESTÉRIL, EMPAQUE INDIVIDUAL, CAJA CON 400 PIEZAS, MARCA SPL LIFE SCIENCES, CATÁLOGO 91005", "requested_quantity": "2000", "minimum_quantity": "2000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "49", "cucop_code": "25401-6575", "specific_item_code": "25401", "cucop_description": "080.709.0378 PIPETAS PIPETA SEROLOGICA DE PLASTICO ESTERIL LIBRE DE PIROGENOS DESECHABLE CON TAPON DE SEGURIDAD (ALGODON) EN EMPAQUE INDIVIDUAL. PARA PIPETOR AUTOMATICO. PARA VOLUMENES: 10 ML. GRADUACION. 10 ML EN 1/10 CAJA CON 200 PIEZAS.", "description": "PIPETA SEROLÓGICA DE 10 ML, COLOR NARANJA, ESTÉRIL, EMPAQUE INDIVIDUAL, CAJA CON 400 PIEZAS, MARCA SPL LIFE SCIENCES, CATÁLOGO 91010", "requested_quantity": "2000", "minimum_quantity": "2000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "50", "cucop_code": "25401-6576", "specific_item_code": "25401", "cucop_description": "080.709.0386 PIPETAS PIPETA SEROLOGICA DE PLASTICO ESTERIL LIBRE DE PIROGENOS DESECHABLE CON TAPON DE SEGURIDAD (ALGODON) EN EMPAQUE INDIVIDUAL. PARA PIPETOR AUTOMATICO. PARA VOLUMENES: 25 ML. GRADUACION. 25 ML EN 1/10 CAJA CON 200 PIEZAS.", "description": "PIPETA SEROLÓGICA DE 25 ML, COLOR ROJO, ESTÉRIL, EMPAQUE INDIVIDUAL, CAJA CON 200 PIEZAS, MARCA SPL LIFE SCIENCES, CATÁLOGO 91025", "requested_quantity": "1000", "minimum_quantity": "1000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "51", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "MICROTUBO 1.5 ML PP, TRM, ESTRIADO, EST, PIEZA, MARCA SARSTEDT, CAJA CON 10 BOLSAS/1000, CATÁLOGO 72.692.005", "requested_quantity": "1000", "minimum_quantity": "1000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "52", "cucop_code": "29501-0005", "specific_item_code": "29501", "cucop_description": "ACCESORIOS DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO", "description": "ETIQUETAS CRIOGÉNICAS ULTRA DELGADAS DE POLIÉSTER FREEZERBONDZ PARA VIALES Y TUBOS CON CINTA DE IMPRESIÓN PARA USO EN LABORATORIOS PARA LAS IMPRESORAS M5 - 0.375\" X 1\" X 0.375\" DIÁ. ROLLO CON 240 ETIQUETAS, MARCA BRADY, CATÁLOGO M5-118-492", "requested_quantity": "14", "minimum_quantity": "14", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "29501", "partida_description": "REFACCIONES Y ACCESORIOS MENORES DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO" }, { "number": "53", "cucop_code": "25501-0090", "specific_item_code": "25501", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "description": "3730XL DNA ANALYZER 96-CAPILLARY ARRAY, 50 CM, PIEZA \n(SE SUGIERE MARCA THERMO FISHER SCIENTIFIC, 4331246)", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "54", "cucop_code": "29501-0005", "specific_item_code": "29501", "cucop_description": "ACCESORIOS DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO", "description": "ETIQUETA DE POLIÉSTER BLANCO SIN IMPRESIÓN CON ADHESIVO PARA PRODUCTOS CONGELADOS DE 38 MM X 25 MM (1.5 X 1\"), ROLLO CON 1,000", "requested_quantity": "305", "minimum_quantity": "305", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "29501", "partida_description": "REFACCIONES Y ACCESORIOS MENORES DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO" }, { "number": "55", "cucop_code": "29501-0005", "specific_item_code": "29501", "cucop_description": "ACCESORIOS DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO", "description": "RIBBON DE RESINA DE 60 MM X 74 MM, CON UNA PIEZA PUEDE IMPRIMIR 2,642 ETIQUETAS DE LA MEDIDA 38 MM X 25 MM (1.5 X 1\")", "requested_quantity": "153", "minimum_quantity": "153", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "29501", "partida_description": "REFACCIONES Y ACCESORIOS MENORES DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO" }, { "number": "56", "cucop_code": "25501-0145", "specific_item_code": "25501", "cucop_description": "CAJA / CONTENEDOR / EMBALAJE DE MUESTRAS", "description": "CAJA DE ALMACENAMIENTO, TAPA SUPERIOR ENCAJADA, CARTÓN, DIMENSIÓN MODULAR: 9 X 9, PARA 81 RECIPIENTES, MEDIDAS 135 X 135 X 45 MM", "requested_quantity": "12", "minimum_quantity": "12", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "57", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETA DE TRANSFERENCIA, 3.5 ML, (LXAN): 146 X 15 MM, LD-PE, TRANSPARENTE, PIEZA, \n(SE SUGIERE MARCA SARSTEDT, CATÁLOGO 86.1175 )", "requested_quantity": "1000", "minimum_quantity": "1000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "58", "cucop_code": "29501-0005", "specific_item_code": "29501", "cucop_description": "ACCESORIOS DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO", "description": "ETIQUETA TÉRMICA DE 2\" X 1\" (5.08MM X 2.54MM), ROLLO DE 2,500 ETIQUETAS CON CENTRO DE CARTÓN DE 1.5\"", "requested_quantity": "170", "minimum_quantity": "170", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "29501", "partida_description": "REFACCIONES Y ACCESORIOS MENORES DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO" }, { "number": "59", "cucop_code": "25501-0145", "specific_item_code": "25501", "cucop_description": "CAJA / CONTENEDOR / EMBALAJE DE MUESTRAS", "description": "CAJA DE ALMACENAMIENTO, TAPA SUPERIOR ENCAJADA, CARTÓN, DIMENSIÓN MODULAR: 9 X 9, PARA 81 RECIPIENTES, PIEZA, \n(SE SUGIERE MARCA SARSTEDT, CATÁLOGO 95.64.981)", "requested_quantity": "2000", "minimum_quantity": "2000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "60", "cucop_code": "25501-0031", "specific_item_code": "25501", "cucop_description": "PIPETA", "description": "PIPETA DE TRANSFERENCIA, 6 ML, (LXAN): 146 X 15 MM, LD-PE, TRANSPARENTE, PIEZA", "requested_quantity": "1000", "minimum_quantity": "1000", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AXYGEN 1.5 ML MAXYCLEAR SNAPLOCK MICROCENTRIFUGE TUBE, POLYPROPYLENE, ASSORTED, NONSTERILE, CAJA CON 5,000 PIEZAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO MCT-150-A)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AXYGEN 0.2 ML THIN WALL PCR TUBES WITH FLAT CAP, ASSORTED COLORS, NONSTERILE, PAQUETE CON 1,000 PIEZAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO PCR-02-A)", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] } ], "budget_items": [ { "code": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "code": "25401", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "code": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "code": "29501", "description": "REFACCIONES Y ACCESORIOS MENORES DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO" } ], "awards": [ { "id": "C-2025-00086879", "internal_reference": "250353", "title": "INSUMOS P/ LA REALIZACIÓN DE PRUEBAS DE CUANTIFICACIÓN DE CARGA VIRAL CIENI", "status": "PUBLICADO", "contractor": { "name": "ABALAT SA DE CV", "normalized_name": "ABALAT", "rfc_type": null, "slug": "abalat" }, "contract_period": { "published_at": "2025-08-18T21:18:25.000Z", "starts_at": "2025-08-19T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "2755782.5", "tax": "440925.2", "total": "3196707.7", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "BIGDYE TERMINATOR V1.1 & V3.1 5X SEQUENCING BUFFER 1 ML, PIEZA, (SE SUGIERE MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4336697)", "unit": "PIEZA", "requested_quantity": "12", "awarded_quantity": null, "unit_price": "1722", "subtotal": "20664", "tax": "3306.24", "other_taxes": null, "total": "23970.24", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BIGDYE TERMINATOR V3.1 CYCLE SEQUENCING KIT 100 REACTIONS, PIEZA\n( SE SUGIERE MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4337455)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "26759", "subtotal": "80277", "tax": "12844.32", "other_taxes": null, "total": "93121.32", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SUPERSCRIPT III ONE-STEP RT-PCR SYSTEM WITH PLATINUM TAQ DNA POLYMERASE 100 REACTIONS \n(SE SUGIERE MARCA INVITROGEN, CATÁLOGO 12574026)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "16197", "subtotal": "48591", "tax": "7774.56", "other_taxes": null, "total": "56365.56", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "EDTA (0.5 M), PH 8.0, RNASE-FREE 100 ML, PIEZA \n(SE SUGIERE MARCA INVITROGEN, CATÁLOGO AM9260G)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1090", "subtotal": "1090", "tax": "174.4", "other_taxes": null, "total": "1264.4", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CERTIFIED MOLECULAR BIOLOGY AGAROSE 500G, PIEZA (SE SSUGIERE MARCA BIO RAD (LIFE SCIENCE), CATÁLOGO 1613102 )", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12687", "subtotal": "12687", "tax": "2029.92", "other_taxes": null, "total": "14716.92", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "PLATINUM TAQ DNA POLYMERASE 600 REACTIONS, PIEZA, \n(SE SUGIERE MARCA INVITROGEN, CATÁLOGO 10966034)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "12878", "subtotal": "38634", "tax": "6181.44", "other_taxes": null, "total": "44815.44", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "MICROAMP OPTICAL 96-WELL REACTION PLATE 500 PLATES, PIEZA,\n (SE SUGIERE MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4316813)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "62215", "subtotal": "62215", "tax": "9954.4", "other_taxes": null, "total": "72169.4", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIS REACTIVO PARA ELECTROFORESIS, BOTE DE 1 KG, \n(SE SUGIERE MARCA BIO RAD (LIFE SCIENCES), CÁTALOGO 1610719)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2509", "subtotal": "2509", "tax": "401.44", "other_taxes": null, "total": "2910.44", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "POP-7 POLYMER FOR 3730/3730XL DNA ANALYZERS, 1 X 28 ML, PIEZA, (SE SUGIERE MARCA APPLIED BIOSYSTEMS, CATÁLOGO 4363929)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "33224", "subtotal": "33224", "tax": "5315.84", "other_taxes": null, "total": "38539.84", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "FG, HI-DI FORMAMIDE 25 ML BOTTLE, \n(SE SUGIERE MARCA APPLIED BIOSYSTEMS (CAT: 4311320))", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1015", "subtotal": "1015", "tax": "162.4", "other_taxes": null, "total": "1177.4", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "E-GEL 96 HIGH RANGE DNA MARKER 100 APLICACIONES,\n(SE SUGIERE MARCHA INVITROGEN (CAT: 12352-019))", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "3345", "subtotal": "10035", "tax": "1605.6", "other_taxes": null, "total": "11640.6", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "3730 RUNNING BUFFER 10 X 500 ML, \n(SE SUGIERE MARCA APPLIED BIOSYSTEMS (CAT: 4335613))", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7855", "subtotal": "7855", "tax": "1256.8", "other_taxes": null, "total": "9111.8", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "MICROAMP 96-WELL FULL PLATE COVER, \n(SE SUGIERE MARCA THERMO FISHER (CAT: N8010550))", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2631", "subtotal": "2631", "tax": "420.96", "other_taxes": null, "total": "3051.96", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "PLATE SEPTA 96 WELL 20 PZAS, \n(SE SUGIERE MARCA APPIED BIOSYSTEMS (CAT: 4315933))", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11539", "subtotal": "11539", "tax": "1846.24", "other_taxes": null, "total": "13385.24", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25401-0015", "description": "AGUJA HIPODÉRMICA PARA TOMA MÚLTIPLE CON BROCHE DE SEGURIDAD, CALIBRE 21G X 32MM.", "unit": "PIEZA", "requested_quantity": "119476", "awarded_quantity": null, "unit_price": "3.5", "subtotal": "418166", "tax": "66906.56", "other_taxes": null, "total": "485072.56", "cucop_description": "AGUJA HIPODERMICA", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-0015", "description": "HOLDER CON BOTÓN AUTOMÁTICO DE EXPULSIÓN DE LA AGUJA O SOPORTE.", "unit": "PIEZA", "requested_quantity": "2582", "awarded_quantity": null, "unit_price": "27.99", "subtotal": "72270.18", "tax": "11563.23", "other_taxes": null, "total": "83833.41", "cucop_description": "AGUJA HIPODERMICA", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-0023", "description": "EQUIPO ALADO TIPO MARIPOSA PARA RECOLECCIÓN DE SANGRE VENOSA, PUSH-BUTTON, COLOR AZUL, 25G X 19MM X 178MM", "unit": "PIEZA", "requested_quantity": "416", "awarded_quantity": null, "unit_price": "28.42", "subtotal": "11822.72", "tax": "1891.64", "other_taxes": null, "total": "13714.36", "cucop_description": "AGUJA PARA PUNCION DE VASOS", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-8158", "description": "TORNIQUETE DE LIBERACIÓN AUTOMÁTICA REUTILIZABLE.", "unit": "PIEZA", "requested_quantity": "200", "awarded_quantity": null, "unit_price": "342.4", "subtotal": "68480", "tax": "10956.8", "other_taxes": null, "total": "79436.8", "cucop_description": "TORNIQUETE MÉDICO", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-8006", "description": "TUBO DE PLÁSTICO CON ANTICOAGULANTE EDTA PARA ANÁLISIS DE SANGRE TOTAL Y/O PLASMA. TAMAÑO 13X75 MM. 4 ML DE CAPACIDAD.", "unit": "PIEZA", "requested_quantity": "111576", "awarded_quantity": null, "unit_price": "2.49", "subtotal": "277824.24", "tax": "44451.88", "other_taxes": null, "total": "322276.12", "cucop_description": "080.909.0137 TUBOS PARA LA TOMA Y RECOLECCION DE SANGRE. DE VIDRIO AL VACIO (13 X 75 MM) DESECHABLE PARA ADULTO CON EDTA TRIPOTASICO (0.048 ML) LIQUIDO TAPON LILA CON SILICON COMO LUBRICANTE VOLUMEN DE DRENADO 4.8-4.9 ML (± 0.3 ML) EL RANGO MENOR ESTABLECE EL VOLUMEN DE DRENADO A LA ALTURA DEL ALTIPLANO MEXICANO Y EL RANGO MAYOR AL NIVEL DEL MAR. ETIQUETADOS INDIVIDUALMENTE CON NUMERO DE LOTE Y FECHA DE CADUCIDAD. CON O SIN TAPON DE SEGURIDAD. CAJA CON 100.", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-8005", "description": "TUBO DE PLÁSTICO CON ANTICOAGULANTE EDTA PARA ANÁLISIS DE SANGRE TOTAL Y/O PLASMA. TAMAÑO 13X100 MM. 6 ML DE CAPACIDAD", "unit": "PIEZA", "requested_quantity": "229672", "awarded_quantity": null, "unit_price": "5.38", "subtotal": "1235635.36", "tax": "197701.66", "other_taxes": null, "total": "1433337.02", "cucop_description": "080.909.0129 TUBOS PARA LA TOMA Y RECOLECCION DE SANGRE. DE VIDRIO AL VACIO (13 X 100 MM) DESECHABLE PARA ADULTO CON EDTA DISODICO (10.5 MG) TAPON LILA CON SILICON COMO LUBRICANTE VOLUMEN DE DRENADO 6.7-7 ML (± 0.3 ML) EL RANGO MENOR ESTABLECE EL VOLUMEN DE DRENADO A LA ALTURA DEL ALTIPLANO MEXICANO Y EL RANGO MAYOR A NIVEL DEL MAR. ETIQUETADOS INDIVIDUALMENTE CON NUMERO DE LOTE Y FECHA DE CADUCIDAD. CON O SIN TAPON DE SEGURIDAD. CAJA CON 100.", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25501-0048", "description": "TUBO DE PLÁSTICO CON ANTICOAGULANTE EDTA PARA ANÁLISIS DE SANGRE TOTAL Y/O PLASMA. VOLUMEN DE RECOLECCIÓN DE 250 – 500 µL", "unit": "PIEZA", "requested_quantity": "5000", "awarded_quantity": null, "unit_price": "9.45", "subtotal": "47250", "tax": "7560", "other_taxes": null, "total": "54810", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0090", "description": "3730XL DNA ANALYZER 96-CAPILLARY ARRAY, 50 CM, PIEZA \n(SE SUGIERE MARCA THERMO FISHER SCIENTIFIC, 4331246)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "145684", "subtotal": "291368", "tax": "46618.88", "other_taxes": null, "total": "337986.88", "cucop_description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2025-00086894", "internal_reference": "250354", "title": "INSUMOS P/ LA REALIZACIÓN DE PRUEBAS DE CUANTIFICACIÓN DE CARGA VIRAL CIENI", "status": "PUBLICADO", "contractor": { "name": "COMERCIAL MEDICA ARZE SA DE CV", "normalized_name": "COMERCIAL MEDICA ARZE", "rfc_type": null, "slug": "comercial-medica-arze" }, "contract_period": { "published_at": "2025-08-18T20:59:18.000Z", "starts_at": "2025-08-19T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "65175.6", "tax": "10428.1", "total": "75603.7", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-1097", "description": "ANTISEPTICOS. ALCOHOL DESNATURALIZADO. ENVASE CON 20 LITROS", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "858.88", "subtotal": "12883.2", "tax": "2061.31", "other_taxes": null, "total": "14944.51", "cucop_description": "060.066.0773 ANTISEPTICOS. ALCOHOL DESNATURALIZADO. ENVASE CON 20 LTS.", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-8702", "description": "GASAS. SECA CORTADA DE ALGODÓN CON MARCA RADIOPACA. LARGO: 10 CM. ANCHO: 10 CM. ENVASE CON 200 PIEZAS.", "unit": "PIEZA", "requested_quantity": "150", "awarded_quantity": null, "unit_price": "165.86", "subtotal": "24879", "tax": "3980.64", "other_taxes": null, "total": "28859.64", "cucop_description": "060.436.0701 GASAS. SECA CORTADA, DE ALGODÓN, DE DOCE CAPAS; CON TEJIDO TIPO III. ANCHO: 10 CM. ESTÉRIL Y DESECHABLE. ENVASE CON DOS Y CINCO PIEZAS.", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-8164", "description": "CUBREBOCAS QUIRÚRGICO. CUBREBOCA QUIRÚRGICO ELABORADO CON DOS CAPAS EXTERNAS DE TELA NO TEJIDA UN FILTRO INTERMEDIO DE POLIPROPILENO; PLANO O PLISADO; CON AJUSTE NASAL MOLDEABLE. RESISTENTE A FLUIDOS ANTIESTÁTICO HIPOALERGÉNICO. CON BANDAS O AJUSTE ELÁSTICO ENTORCHADO A LA CABEZA O RETROAURICULAR. DESECHABLE. PIEZA.", "unit": "PIEZA", "requested_quantity": "6120", "awarded_quantity": null, "unit_price": "9.3", "subtotal": "5691.6", "tax": "910.66", "other_taxes": null, "total": "6602.26", "cucop_description": "060.621.0656 CUBREBOCAS QUIRÚRGICO ELABORADO CON DOS CAPAS EXTERNAS DE TELA NO TEJIDA, UN FILTRO INTERMEDIO DE POLIPROPILENO; PLANO O PLISADO; CON AJUSTE NASAL MOLDEABLE. RESISTENTE A FLUIDOS, ANTIESTÁTICO, HIPOALERGÉNICO. CON BANDAS O AJUSTE ELÁSTICO ENTORCHADO A LA CABEZA O RETROAURICULAR", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-8677", "description": "BATA QUIRÚRGICA CON PUÑOS AJUSTABLES Y REFUERZO EN MANGAS Y PECHO. TELA NO TEJIDA DE POLIPROPILENO IMPERMEABLE A LA PENETRACIÓN DE LÍQUIDOS Y FLUIDOS ; ANTIESTÁTICA Y RESISTENTE A LA TENSIÓN. ESTÉRIL Y DESECHABLE. TAMAÑO: GRANDE PIEZA.", "unit": "PIEZA", "requested_quantity": "820", "awarded_quantity": null, "unit_price": "26.49", "subtotal": "21721.8", "tax": "3475.49", "other_taxes": null, "total": "25197.29", "cucop_description": "060.231.0641 BATAS QUIRÚRGICAS", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" } ] }, { "id": "C-2025-00086905", "internal_reference": "250355", "title": "INSUMOS P/ LA REALIZACIÓN DE PRUEBAS DE CUANTIFICACIÓN DE CARGA VIRAL CIENI", "status": "PUBLICADO", "contractor": { "name": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "normalized_name": "CONTROL TECNICO Y REPRESENTACIONES", "rfc_type": null, "slug": "control-tecnico-y-representaciones" }, "contract_period": { "published_at": "2025-08-18T20:51:37.000Z", "starts_at": "2025-08-19T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "1440702", "tax": "230512.32", "total": "1671214.32", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "QIAAMP VIRAL RNA MINI KIT (250)\n(SE SUGIERE MARCA QIAGEN CAT. 52906)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "33429", "subtotal": "33429", "tax": "5348.64", "other_taxes": null, "total": "38777.64", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "QIAQUICK PCR PURIFICATION KIT (250 PRUEBAS) \n(SE SUGIERE MARCA QIAGEN CAT. 28106 PIEZA)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "14890", "subtotal": "29780", "tax": "4764.8", "other_taxes": null, "total": "34544.8", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETHYL ALCOHOL, PURE =99.45%, FOR MOLECULAR BIOLOGY, 200 PROOF, SUITABLE FOR RNA EXTRACTION AND DNA EXTRACTION, 1 L, PIEZA \n(SE SUGIERE MARCA SIGMA ALDRICH, CATÁLOGO E7023-1L)", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "3220", "subtotal": "22540", "tax": "3606.4", "other_taxes": null, "total": "26146.4", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "TUBOS PCR DE PARED FINA DE 0,2 ML CON TAPA PLANA, COLORES SURTIDOS, NO ESTÉRILES", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "687", "subtotal": "687", "tax": "109.92", "other_taxes": null, "total": "796.92", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "DEOXYNUCLEOSIDE TRIPHOSPHATE SET, PCR GRADE, \n(SE SUGIERE MARCA ROCHE, CATÁLOGO 11969064001)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6603", "subtotal": "6603", "tax": "1056.48", "other_taxes": null, "total": "7659.48", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BORIC ACID SUITABLE FOR ELECTROPHORESIS, =99.5%, 1 KG, PIEZA, \n(SE SUGIERE MARCA SIGMA ALDRICH, CATÁLOGO B7901-1KG)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3098", "subtotal": "3098", "tax": "495.68", "other_taxes": null, "total": "3593.68", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AXYGEN 10 µL MAXYMUM RECOVERY PIPET TIPS, FILTERED, CLEAR, STERILE, LONG LENGTH, CAJA CON 50 RACK DE 96 PUNTAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO TXLF-10-L-R-S)", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "9416", "subtotal": "47080", "tax": "7532.8", "other_taxes": null, "total": "54612.8", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AXYGEN 100 µL MAXYMUM RECOVERY UNIVERSAL FIT FILTER TIPS, CLEAR, STERILE, CAJA CON 50 RACK DE 96 PUNTAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO TF-100-L-R-S)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "11438", "subtotal": "34314", "tax": "5490.24", "other_taxes": null, "total": "39804.24", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AXYGEN 200 µL MAXYMUM RECOVERY UNIVERSAL FIT FILTER TIPS, CLEAR, CAJA CON 50 RACK DE 96 PUNTAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO TF-200-L-R-S)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11558", "subtotal": "23116", "tax": "3698.56", "other_taxes": null, "total": "26814.56", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AXYGEN 1000 µL MAXYMUM RECOVERY UNIVERSAL FIT FILTERTIPS, CLEAR, STERILE, CAJA CON 50 RACKS DE 100 PUNTAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO TF-1000-L-R-S)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10904", "subtotal": "21808", "tax": "3489.28", "other_taxes": null, "total": "25297.28", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AXYGEN 20 µL MAXYMUM RECOVERY UNIVERSAL FIT FILTER TIPS RACKED, CLEAR, STERILE, CAJA CON 50 RACK DE 96 PUNTAS,\n(SE SUGIERE MARCA CORNING, CATÁLOGO TF-20-L-R-S)", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "7595", "subtotal": "22785", "tax": "3645.6", "other_taxes": null, "total": "26430.6", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0048", "description": "VIAL CRIOGÉNICO DE POLIPROPILENO CON ROSCA INTERNA DE 4 ML, AUTOPORTANTE Y FONDO REDONDO", "unit": "PIEZA", "requested_quantity": "3553", "awarded_quantity": null, "unit_price": "329", "subtotal": "1168937", "tax": "187029.92", "other_taxes": null, "total": "1355966.92", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0048", "description": "COLLECTION TUBES (2ML) \n(SE SUGIERE MARCA QIAGEN 1000 CAT. 19201)", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5195", "subtotal": "10390", "tax": "1662.4", "other_taxes": null, "total": "12052.4", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "SET DE PRIMERS:\nPR 5’ OUTER / CCCCTAGGAAAAAGGGCTGTTG / 22 BASES / 200 NMOL / DST \nRT 3’ OUTER / GTTTTCAGATTTTTAAATGGCTCTTG / 26 BASES / 200 NMOL / DST \nPR 5’ INNER / TGAAAGATTGTACTGAGAGACAGG / 24 BASES / 200 NMOL / DST \nRT 3’ INNER / GGCTCTTGATAAATTTGATATGTCC / 25 BASES / 200 NMOL / DST \nPOL_A / CCAGAAGAGAGCTTCAGGTCTGGGG / 25 BASES / 200 NMOL / DST \nPOL_B / GTTAAACAATGGCCATTGACAGAAG / 25 BASES / 200 NMOL / DST \nPOL_C / GGAAAGGATCACCAGCAATATTCCA / 25 BASES / 200 NMOL / DST \nPOL_D / CCCTCARATCACTCTTTGGCAACG / 24 BASES / 200 NMOL / DST \nPOL_F / CTTTTGGGCCATCCATTCCTGGCTT / 25 BASES / 200 NMOL / DST \nPOL_G / CCATCCCTGTGGAAGCACATTGTA / 24 BASES / 200 NMOL / DST \nPOL_H / TGCCCCTGCTTCTGTATTTCTGCTA / 25 BASES / 200 NMOL / DST\n\n(SE SUGIERE MARCA (T4 OLIGO))", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6293", "subtotal": "12586", "tax": "2013.76", "other_taxes": null, "total": "14599.76", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AXYGEN 1.5 ML MAXYCLEAR SNAPLOCK MICROCENTRIFUGE TUBE, POLYPROPYLENE, ASSORTED, NONSTERILE, CAJA CON 5,000 PIEZAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO MCT-150-A)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2862", "subtotal": "2862", "tax": "457.92", "other_taxes": null, "total": "3319.92", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AXYGEN 0.2 ML THIN WALL PCR TUBES WITH FLAT CAP, ASSORTED COLORS, NONSTERILE, PAQUETE CON 1,000 PIEZAS, \n(SE SUGIERE MARCA CORNING, CATÁLOGO PCR-02-A)", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "687", "subtotal": "687", "tax": "109.92", "other_taxes": null, "total": "796.92", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2025-00086911", "internal_reference": "250356", "title": "INSUMOS P/ LA REALIZACIÓN DE PRUEBAS DE CUANTIFICACIÓN DE CARGA VIRAL CIENI", "status": "PUBLICADO", "contractor": { "name": "PROVEEDORA NACIONAL DE MATERIAL DE CURACION SA DE CV", "normalized_name": "PROVEEDORA NACIONAL DE MATERIAL DE CURACION", "rfc_type": null, "slug": "proveedora-nacional-de-material-de-curacion" }, "contract_period": { "published_at": "2025-08-18T20:50:24.000Z", "starts_at": "2025-08-19T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "201591.28", "tax": "32254.6", "total": "233845.88", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-0046", "description": "BANDITA ADHESIVA REDONDA CON APÓSITO CENTRAL DE ACRÍLICO, HIPOALERGÉNICA DE ±22 MM DE DIÁMETRO, COLOR PIEL.", "unit": "PIEZA", "requested_quantity": "44836", "awarded_quantity": null, "unit_price": "0.49", "subtotal": "21969.64", "tax": "3515.14", "other_taxes": null, "total": "25484.78", "cucop_description": "BANDA ADHESIVA", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-0505", "description": "TOALLITAS ANTISÉPTICAS INDIVIDUALES IMPREGNADAS CON ALCOHOL ISOPROPÍLICO AL 70% PARA LIMPIEZA PREVIA A LA PUNCIÓN.", "unit": "PIEZA", "requested_quantity": "181436", "awarded_quantity": null, "unit_price": "0.99", "subtotal": "179621.64", "tax": "28739.46", "other_taxes": null, "total": "208361.1", "cucop_description": "TORUNDA ALGODON", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" } ] }, { "id": "C-2025-00086925", "internal_reference": "250357", "title": "INSUMOS P/ LA REALIZACIÓN DE PRUEBAS DE CUANTIFICACIÓN DE CARGA VIRAL CIENI", "status": "PUBLICADO", "contractor": { "name": "SARSTEDT MEXICO S DE RL DE CV", "normalized_name": "SARSTEDT MEXICO", "rfc_type": null, "slug": "sarstedt-mexico" }, "contract_period": { "published_at": "2025-08-18T20:48:27.000Z", "starts_at": "2025-08-19T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "219634.04", "tax": "35141.45", "total": "254775.49", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25401-6574", "description": "PIPETA SEROLÓGICA DE 5 ML, COLOR AZUL, ESTÉRIL, EMPAQUE INDIVIDUAL, CAJA CON 400 PIEZAS, MARCA SPL LIFE SCIENCES, CATÁLOGO 91005", "unit": "PIEZA", "requested_quantity": "2000", "awarded_quantity": null, "unit_price": "3.62", "subtotal": "7240", "tax": "1158.4", "other_taxes": null, "total": "8398.4", "cucop_description": "080.709.0360 PIPETAS PIPETA SEROLOGICA DE PLASTICO ESTERIL LIBRE DE PIROGENOS DESECHABLE CON TAPON DE SEGURIDAD (ALGODON) EN EMPAQUE INDIVIDUAL. PARA PIPETOR AUTOMATICO. PARA VOLUMENES: 5 ML. GRADUACION. 5 ML EN 1/10 CAJA CON 200 PIEZAS.", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-6575", "description": "PIPETA SEROLÓGICA DE 10 ML, COLOR NARANJA, ESTÉRIL, EMPAQUE INDIVIDUAL, CAJA CON 400 PIEZAS, MARCA SPL LIFE SCIENCES, CATÁLOGO 91010", "unit": "PIEZA", "requested_quantity": "2000", "awarded_quantity": null, "unit_price": "4.17", "subtotal": "8340", "tax": "1334.4", "other_taxes": null, "total": "9674.4", "cucop_description": "080.709.0378 PIPETAS PIPETA SEROLOGICA DE PLASTICO ESTERIL LIBRE DE PIROGENOS DESECHABLE CON TAPON DE SEGURIDAD (ALGODON) EN EMPAQUE INDIVIDUAL. PARA PIPETOR AUTOMATICO. PARA VOLUMENES: 10 ML. GRADUACION. 10 ML EN 1/10 CAJA CON 200 PIEZAS.", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25401-6576", "description": "PIPETA SEROLÓGICA DE 25 ML, COLOR ROJO, ESTÉRIL, EMPAQUE INDIVIDUAL, CAJA CON 200 PIEZAS, MARCA SPL LIFE SCIENCES, CATÁLOGO 91025", "unit": "PIEZA", "requested_quantity": "1000", "awarded_quantity": null, "unit_price": "6.73", "subtotal": "6730", "tax": "1076.8", "other_taxes": null, "total": "7806.8", "cucop_description": "080.709.0386 PIPETAS PIPETA SEROLOGICA DE PLASTICO ESTERIL LIBRE DE PIROGENOS DESECHABLE CON TAPON DE SEGURIDAD (ALGODON) EN EMPAQUE INDIVIDUAL. PARA PIPETOR AUTOMATICO. PARA VOLUMENES: 25 ML. GRADUACION. 25 ML EN 1/10 CAJA CON 200 PIEZAS.", "partida_code": "25401", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS MÉDICOS" }, { "number": "0", "cucop_code": "25501-0048", "description": "MICROTUBO 1.5 ML PP, TRM, ESTRIADO, EST, PIEZA, MARCA SARSTEDT, CAJA CON 10 BOLSAS/1000, CATÁLOGO 72.692.005", "unit": "PIEZA", "requested_quantity": "1000", "awarded_quantity": null, "unit_price": "2.1", "subtotal": "2100", "tax": "336", "other_taxes": null, "total": "2436", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0145", "description": "CAJA DE ALMACENAMIENTO, TAPA SUPERIOR ENCAJADA, CARTÓN, DIMENSIÓN MODULAR: 9 X 9, PARA 81 RECIPIENTES, MEDIDAS 135 X 135 X 45 MM", "unit": "PIEZA", "requested_quantity": "12", "awarded_quantity": null, "unit_price": "95.67", "subtotal": "1148.04", "tax": "183.69", "other_taxes": null, "total": "1331.73", "cucop_description": "CAJA / CONTENEDOR / EMBALAJE DE MUESTRAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0031", "description": "PIPETA DE TRANSFERENCIA, 3.5 ML, (LXAN): 146 X 15 MM, LD-PE, TRANSPARENTE, PIEZA, \n(SE SUGIERE MARCA SARSTEDT, CATÁLOGO 86.1175 )", "unit": "PIEZA", "requested_quantity": "1000", "awarded_quantity": null, "unit_price": "1.14", "subtotal": "1368", "tax": "218.88", "other_taxes": null, "total": "1586.88", "cucop_description": "PIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0145", "description": "CAJA DE ALMACENAMIENTO, TAPA SUPERIOR ENCAJADA, CARTÓN, DIMENSIÓN MODULAR: 9 X 9, PARA 81 RECIPIENTES, PIEZA, \n(SE SUGIERE MARCA SARSTEDT, CATÁLOGO 95.64.981)", "unit": "PIEZA", "requested_quantity": "2000", "awarded_quantity": null, "unit_price": "95.67", "subtotal": "191340", "tax": "30614.4", "other_taxes": null, "total": "221954.4", "cucop_description": "CAJA / CONTENEDOR / EMBALAJE DE MUESTRAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0031", "description": "PIPETA DE TRANSFERENCIA, 6 ML, (LXAN): 146 X 15 MM, LD-PE, TRANSPARENTE, PIEZA", "unit": "PIEZA", "requested_quantity": "1000", "awarded_quantity": null, "unit_price": "1.14", "subtotal": "1368", "tax": "218.88", "other_taxes": null, "total": "1586.88", "cucop_description": "PIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2025-00086934", "internal_reference": "250358", "title": "INSUMOS P/ LA REALIZACIÓN DE PRUEBAS DE CUANTIFICACIÓN DE CARGA VIRAL CIENI", "status": "PUBLICADO", "contractor": { "name": "SILVERA CIENCIA E INGENIERIA SA DE CV", "normalized_name": "SILVERA CIENCIA E INGENIERIA", "rfc_type": null, "slug": "silvera-ciencia-e-ingenieria" }, "contract_period": { "published_at": "2025-08-18T20:29:17.000Z", "starts_at": "2025-08-19T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "2350", "tax": "376", "total": "2726", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "MICROCENTRIFUGE TUBE 1.5 ML, PP, 5 COLORS, CAJA CON 5,000 PIEZAS, (SE SUGIERE MARCA SPL LIFE SCIENCES, CATÁLOGO 61015)", "unit": "PIEZA", "requested_quantity": "5000", "awarded_quantity": null, "unit_price": "235", "subtotal": "2350", "tax": "376", "other_taxes": null, "total": "2726", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2025-00086931", "internal_reference": "250359", "title": "INSUMOS P/ LA REALIZACIÓN DE PRUEBAS DE CUANTIFICACIÓN DE CARGA VIRAL CIENI", "status": "PUBLICADO", "contractor": { "name": "GRUPO VEROMO SA DE CV", "normalized_name": "GRUPO VEROMO", "rfc_type": null, "slug": "grupo-veromo" }, "contract_period": { "published_at": "2025-08-18T20:41:56.000Z", "starts_at": "2025-08-19T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "52768.85", "tax": "8443.02", "total": "61211.87", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "29501-0005", "description": "ETIQUETA DE POLIÉSTER BLANCO SIN IMPRESIÓN CON ADHESIVO PARA PRODUCTOS CONGELADOS DE 38 MM X 25 MM (1.5 X 1\"), ROLLO CON 1,000", "unit": "PIEZA", "requested_quantity": "305", "awarded_quantity": null, "unit_price": "45.9", "subtotal": "13999.5", "tax": "2239.92", "other_taxes": null, "total": "16239.42", "cucop_description": "ACCESORIOS DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO", "partida_code": "29501", "partida_description": "REFACCIONES Y ACCESORIOS MENORES DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO" }, { "number": "0", "cucop_code": "29501-0005", "description": "RIBBON DE RESINA DE 60 MM X 74 MM, CON UNA PIEZA PUEDE IMPRIMIR 2,642 ETIQUETAS DE LA MEDIDA 38 MM X 25 MM (1.5 X 1\")", "unit": "PIEZA", "requested_quantity": "153", "awarded_quantity": null, "unit_price": "153.95", "subtotal": "23554.35", "tax": "3768.7", "other_taxes": null, "total": "27323.05", "cucop_description": "ACCESORIOS DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO", "partida_code": "29501", "partida_description": "REFACCIONES Y ACCESORIOS MENORES DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO" }, { "number": "0", "cucop_code": "29501-0005", "description": "ETIQUETA TÉRMICA DE 2\" X 1\" (5.08MM X 2.54MM), ROLLO DE 2,500 ETIQUETAS CON CENTRO DE CARTÓN DE 1.5\"", "unit": "PIEZA", "requested_quantity": "170", "awarded_quantity": null, "unit_price": "89.5", "subtotal": "15215", "tax": "2434.4", "other_taxes": null, "total": "17649.4", "cucop_description": "ACCESORIOS DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO", "partida_code": "29501", "partida_description": "REFACCIONES Y ACCESORIOS MENORES DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "SOLICITUD DE COTIZACIÓN", "filename": "3439 FOCON 04.pdf", "availability": "available", "size_bytes": "1477502", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T14:52:21.161Z", "updated_at": "2025-12-03T14:52:21.162Z" }, { "id": null, "annex_number": 2, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "ANEXO TEC 3439.pdf", "availability": "available", "size_bytes": "1103272", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T14:52:23.345Z", "updated_at": "2025-12-03T14:52:23.346Z" }, { "id": null, "annex_number": 4, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT_ 250354.pdf", "availability": "available", "size_bytes": "557880", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T14:52:25.801Z", "updated_at": "2025-12-03T14:52:25.802Z" }, { "id": null, "annex_number": 5, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT_ 250355.pdf", "availability": "available", "size_bytes": "560281", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T14:52:28.796Z", "updated_at": "2025-12-03T14:52:28.797Z" }, { "id": null, "annex_number": 6, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT_ 250356.pdf", "availability": "available", "size_bytes": "568423", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T14:52:31.518Z", "updated_at": "2025-12-03T14:52:31.519Z" }, { "id": null, "annex_number": 7, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT_ 250357.pdf", "availability": "available", "size_bytes": "561176", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T14:52:33.372Z", "updated_at": "2025-12-03T14:52:33.373Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT_250359.pdf", "availability": "available", "size_bytes": "559027", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T14:52:36.005Z", "updated_at": "2025-12-03T14:52:36.007Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "PEDIDO 250358.pdf", "availability": "available", "size_bytes": "500930", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T14:52:38.516Z", "updated_at": "2025-12-03T14:52:38.517Z" }, { "id": null, "annex_number": 10, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "NOT_ 250353.pdf", "availability": "available", "size_bytes": "562904", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-03T14:52:41.110Z", "updated_at": "2025-12-03T14:52:41.112Z" } ], "provenance": { "source_system": "Compras MX", "source_fetched_at": "2026-08-03T10:19:26.992Z", "last_seen_at": "2026-08-03T10:52:40.680Z", "first_seen_at": "2025-11-04T22:05:24.502Z", "detail_complete": true, "documents_complete": true, "content_changed_at": "2025-11-04T22:05:24.502Z" }, "context": { "prices": [ { "cucop_code": "25101-0037", "description": "REACTIVOS ANALITICOS", "priced_items": 44908, "units": [ { "n": 37743, "max": 280215502.56, "min": 0.53, "p10": 257, "p50": 3160, "p90": 19101.912, "unidad": "PIEZA" }, { "n": 3116, "max": 389753, "min": 2.25, "p10": 400, "p50": 2371.685, "p90": 18751.455, "unidad": "LITRO" }, { "n": 2930, "max": 1567806.8, "min": 1, "p10": 120, "p50": 3200, "p90": 17597.42, "unidad": "UNIDAD" }, { "n": 249, "max": 111832796, "min": 3.81, "p10": 885.8, "p50": 31540, "p90": 8964611.16, "unidad": "SERVICIO" }, { "n": 204, "max": 48058.42, "min": 140, "p10": 516.839, "p50": 15109.01, "p90": 33997.005, "unidad": "MILILITRO" }, { "n": 147, "max": 66620.51, "min": 0.75, "p10": 294.948, "p50": 1414, "p90": 7859.608, "unidad": "GRAMO" }, { "n": 142, "max": 68318.25, "min": 12.93, "p10": 72.992, "p50": 895.05, "p90": 5181.9, "unidad": "KILOGRAMO" }, { "n": 142, "max": 24971469.93, "min": 18, "p10": 1215.2, "p50": 65495.585, "p90": 457938.306, "unidad": "LOTE" }, { "n": 65, "max": 33900, "min": 208, "p10": 647.412, "p50": 2063.45, "p90": 5323.4, "unidad": "GALON" }, { "n": 59, "max": 120750, "min": 58.5, "p10": 112.396, "p50": 1561.88, "p90": 13849.984, "unidad": "TESLA" }, { "n": 58, "max": 21600, "min": 16.04, "p10": 22.329, "p50": 110.985, "p90": 691, "unidad": "METRO CUBICO" }, { "n": 28, "max": 12722.17, "min": 119, "p10": 698.229, "p50": 1903.5, "p90": 4866.035, "unidad": "MILIGRAMO" }, { "n": 25, "max": 103489.92, "min": 1617, "p10": 11250.8, "p50": 14200.9, "p90": 57843.788, "unidad": "KILOGRAMO POR HORA" } ], "price_by_year": { "2023": { "n": 14653, "p50": 2420 }, "2024": { "n": 13438, "p50": 3500 }, "2025": { "n": 8626, "p50": 4177.3 }, "2026": { "n": 8191, "p50": 2958 } }, "refreshed_at": "2026-09-24T05:35:01.565Z" }, { "cucop_code": "25401-0015", "description": "AGUJA HIPODERMICA", "priced_items": 679, "units": [ { "n": 647, "max": 242063.5, "min": 0.47, "p10": 30, "p50": 181, "p90": 1956.8, "unidad": "PIEZA" }, { "n": 28, "max": 280, "min": 0.78, "p10": 0.911, "p50": 97.5, "p90": 155.625, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 243, "p50": 250 }, "2024": { "n": 188, "p50": 184.8 }, "2025": { "n": 101, "p50": 65 }, "2026": { "n": 147, "p50": 153.62 } }, "refreshed_at": "2026-09-18T22:37:56.148Z" }, { "cucop_code": "25401-0023", "description": "AGUJA PARA PUNCION DE VASOS", "priced_items": 159, "units": [ { "n": 147, "max": 171000, "min": 1, "p10": 100, "p50": 291.02, "p90": 28967.16, "unidad": "PIEZA" }, { "n": 11, "max": 5988, "min": 55.2, "p10": 97.53, "p50": 264.5, "p90": 906, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 55, "p50": 234.52 }, "2024": { "n": 50, "p50": 263.5 }, "2025": { "n": 21, "p50": 570.97 }, "2026": { "n": 33, "p50": 11705 } }, "refreshed_at": "2026-09-18T22:37:56.148Z" }, { "cucop_code": "25401-8158", "description": "TORNIQUETE MÉDICO", "priced_items": 63, "units": [ { "n": 62, "max": 23200, "min": 1, "p10": 70.5, "p50": 255, "p90": 2118.15, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 6, "p50": 495 }, "2024": { "n": 17, "p50": 364.62 }, "2025": { "n": 23, "p50": 232.62 }, "2026": { "n": 17, "p50": 250 } }, "refreshed_at": "2026-09-18T22:38:21.579Z" }, { "cucop_code": "25401-8006", "description": "080.909.0137 TUBOS PARA LA TOMA Y RECOLECCION DE SANGRE. DE VIDRIO AL VACIO (13 X 75 MM) DESECHABLE PARA ADULTO CON EDTA TRIPOTASICO (0.048 ML) LIQUIDO TAPON LILA CON SILICON COMO LUBRICANTE VOLUMEN DE DRENADO 4.8-4.9 ML (± 0.3 ML) EL RANGO MENOR ESTABLECE EL VOLUMEN DE DRENADO A LA ALTURA DEL ALTIPLANO MEXICANO Y EL RANGO MAYOR AL NIVEL DEL MAR. ETIQUETADOS INDIVIDUALMENTE CON NUMERO DE LOTE Y FECHA DE CADUCIDAD. CON O SIN TAPON DE SEGURIDAD. CAJA CON 100.", "priced_items": 20, "units": [ { "n": 14, "max": 2385, "min": 2.49, "p10": 232.722, "p50": 286.77, "p90": 575.5, "unidad": "PIEZA" }, { "n": 6, "max": 323.24, "min": 221, "p10": 258.265, "p50": 314.625, "p90": 320.62, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 12, "p50": 303.415 }, "2024": { "n": 5, "p50": 287.54 }, "2025": { "n": 1, "p50": 2.49 }, "2026": { "n": 2, "p50": 552.5 } }, "refreshed_at": "2026-09-18T22:38:21.235Z" }, { "cucop_code": "25401-8005", "description": "080.909.0129 TUBOS PARA LA TOMA Y RECOLECCION DE SANGRE. DE VIDRIO AL VACIO (13 X 100 MM) DESECHABLE PARA ADULTO CON EDTA DISODICO (10.5 MG) TAPON LILA CON SILICON COMO LUBRICANTE VOLUMEN DE DRENADO 6.7-7 ML (± 0.3 ML) EL RANGO MENOR ESTABLECE EL VOLUMEN DE DRENADO A LA ALTURA DEL ALTIPLANO MEXICANO Y EL RANGO MAYOR A NIVEL DEL MAR. ETIQUETADOS INDIVIDUALMENTE CON NUMERO DE LOTE Y FECHA DE CADUCIDAD. CON O SIN TAPON DE SEGURIDAD. CAJA CON 100.", "priced_items": 9, "units": [ { "n": 8, "max": 5712.7, "min": 5.38, "p10": 281.614, "p50": 502.65, "p90": 2588.81, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 3, "p50": 480 }, "2024": { "n": 3, "p50": 485 }, "2025": { "n": 1, "p50": 5.38 }, "2026": { "n": 2, "p50": 1052.5 } }, "refreshed_at": "2026-09-18T22:38:21.235Z" }, { "cucop_code": "25501-0048", "description": "TUBO MUESTRADOR", "priced_items": 1252, "units": [ { "n": 1145, "max": 114987, "min": 0.54, "p10": 154.224, "p50": 579.08, "p90": 3960.4, "unidad": "PIEZA" }, { "n": 98, "max": 8348.6, "min": 1.57, "p10": 203.1, "p50": 635.325, "p90": 3979, "unidad": "UNIDAD" }, { "n": 6, "max": 6034.48, "min": 370.23, "p10": 825.085, "p50": 2131.55, "p90": 4612.065, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 608, "p50": 462.5 }, "2024": { "n": 281, "p50": 560 }, "2025": { "n": 221, "p50": 955 }, "2026": { "n": 142, "p50": 649.01 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0090", "description": "MATERIAL DE PLASTICO PARA USO EN LABORATORIO DE MEDICION", "priced_items": 6665, "units": [ { "n": 6255, "max": 4310344.83, "min": 0.087, "p10": 75, "p50": 980.5, "p90": 6897.812, "unidad": "PIEZA" }, { "n": 316, "max": 95846, "min": 1, "p10": 126.645, "p50": 939.5, "p90": 5621, "unidad": "UNIDAD" }, { "n": 60, "max": 16850778, "min": 8.21, "p10": 63.591, "p50": 2272.445, "p90": 138777.127, "unidad": "LOTE" }, { "n": 12, "max": 4743.75, "min": 17.27, "p10": 41.32, "p50": 292.25, "p90": 837.8, "unidad": "METRO" }, { "n": 8, "max": 3710.85, "min": 31.03, "p10": 57.588, "p50": 126.875, "p90": 1319.755, "unidad": "KILOGRAMO" }, { "n": 6, "max": 11100, "min": 2.3, "p10": 4.15, "p50": 79.515, "p90": 6415.08, "unidad": "SERVICIO" }, { "n": 5, "max": 547.5, "min": 208.89, "p10": 208.89, "p50": 304.33, "p90": 468.752, "unidad": "KILOGRAMO POR HORA" }, { "n": 3, "max": 2768.26, "min": 413.85, "p10": 615.88, "p50": 1424, "p90": 2499.408, "unidad": "LITRO" } ], "price_by_year": { "2023": { "n": 2341, "p50": 840 }, "2024": { "n": 1689, "p50": 1080.21 }, "2025": { "n": 1629, "p50": 940 }, "2026": { "n": 1006, "p50": 1095.25 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25401-1097", "description": "060.066.0773 ANTISEPTICOS. ALCOHOL DESNATURALIZADO. ENVASE CON 20 LTS.", "priced_items": 103, "units": [ { "n": 85, "max": 10640, "min": 19.3, "p10": 312.204, "p50": 785, "p90": 3172.744, "unidad": "PIEZA" }, { "n": 17, "max": 1350, "min": 503.88, "p10": 526.914, "p50": 650.75, "p90": 1074.676, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 4, "p50": 1095.1 }, "2024": { "n": 47, "p50": 750 }, "2025": { "n": 18, "p50": 650.75 }, "2026": { "n": 34, "p50": 745.71 } }, "refreshed_at": "2026-09-25T21:15:01.948Z" }, { "cucop_code": "25401-8702", "description": "060.436.0701 GASAS. SECA CORTADA, DE ALGODÓN, DE DOCE CAPAS; CON TEJIDO TIPO III. ANCHO: 10 CM. ESTÉRIL Y DESECHABLE. ENVASE CON DOS Y CINCO PIEZAS.", "priced_items": 45, "units": [ { "n": 28, "max": 350, "min": 10.5, "p10": 11.184, "p50": 13.05, "p90": 194.6, "unidad": "PIEZA" }, { "n": 17, "max": 79.5, "min": 8.14, "p10": 8.14, "p50": 8.14, "p90": 11.98, "unidad": "UNIDAD" } ], "price_by_year": { "2025": { "n": 36, "p50": 11.27 }, "2026": { "n": 9, "p50": 79.5 } }, "refreshed_at": "2026-09-18T22:38:24.215Z" }, { "cucop_code": "25401-8164", "description": "060.621.0656 CUBREBOCAS QUIRÚRGICO ELABORADO CON DOS CAPAS EXTERNAS DE TELA NO TEJIDA, UN FILTRO INTERMEDIO DE POLIPROPILENO; PLANO O PLISADO; CON AJUSTE NASAL MOLDEABLE. RESISTENTE A FLUIDOS, ANTIESTÁTICO, HIPOALERGÉNICO. CON BANDAS O AJUSTE ELÁSTICO ENTORCHADO A LA CABEZA O RETROAURICULAR", "priced_items": 120, "units": [ { "n": 108, "max": 726, "min": 0.27, "p10": 0.43, "p50": 0.79, "p90": 76.5, "unidad": "PIEZA" }, { "n": 12, "max": 1956, "min": 0.38, "p10": 0.38, "p50": 0.5, "p90": 97.77, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 9, "p50": 0.85 }, "2024": { "n": 37, "p50": 0.58 }, "2025": { "n": 53, "p50": 0.71 }, "2026": { "n": 21, "p50": 43.43 } }, "refreshed_at": "2026-09-18T22:38:21.579Z" }, { "cucop_code": "25401-8677", "description": "060.231.0641 BATAS QUIRÚRGICAS", "priced_items": 125, "units": [ { "n": 81, "max": 10900, "min": 15.05, "p10": 17.59, "p50": 27.7333, "p90": 98.01, "unidad": "PIEZA" }, { "n": 44, "max": 67.24, "min": 20.23, "p10": 20.23, "p50": 24.37, "p90": 26, "unidad": "UNIDAD" } ], "price_by_year": { "2024": { "n": 50, "p50": 27.5517 }, "2025": { "n": 68, "p50": 24.37 }, "2026": { "n": 7, "p50": 51 } }, "refreshed_at": "2026-09-18T22:38:24.215Z" }, { "cucop_code": "25401-0046", "description": "BANDA ADHESIVA", "priced_items": 120, "units": [ { "n": 113, "max": 7609.75, "min": 0.49, "p10": 35.306, "p50": 156, "p90": 1190, "unidad": "PIEZA" }, { "n": 6, "max": 16786, "min": 25, "p10": 42, "p50": 460.875, "p90": 8813, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 33, "p50": 194 }, "2024": { "n": 37, "p50": 205 }, "2025": { "n": 29, "p50": 116 }, "2026": { "n": 21, "p50": 74.52 } }, "refreshed_at": "2026-09-18T22:37:56.148Z" }, { "cucop_code": "25401-0505", "description": "TORUNDA ALGODON", "priced_items": 204, "units": [ { "n": 192, "max": 6408.5, "min": 0.24, "p10": 39.3, "p50": 98.43, "p90": 260.366, "unidad": "PIEZA" }, { "n": 11, "max": 250, "min": 32.86, "p10": 64.5, "p50": 100, "p90": 215, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 58, "p50": 100 }, "2024": { "n": 59, "p50": 98 }, "2025": { "n": 47, "p50": 96.15 }, "2026": { "n": 40, "p50": 101.435 } }, "refreshed_at": "2026-09-18T22:38:01.314Z" }, { "cucop_code": "25401-6574", "description": "080.709.0360 PIPETAS PIPETA SEROLOGICA DE PLASTICO ESTERIL LIBRE DE PIROGENOS DESECHABLE CON TAPON DE SEGURIDAD (ALGODON) EN EMPAQUE INDIVIDUAL. PARA PIPETOR AUTOMATICO. PARA VOLUMENES: 5 ML. GRADUACION. 5 ML EN 1/10 CAJA CON 200 PIEZAS.", "priced_items": 11, "units": [ { "n": 11, "max": 724, "min": 3.62, "p10": 3.62, "p50": 354.48, "p90": 716.4, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 3, "p50": 398 }, "2024": { "n": 1, "p50": 354.48 }, "2025": { "n": 5, "p50": 209 }, "2026": { "n": 2, "p50": 362.58 } }, "refreshed_at": "2026-09-18T22:38:19.421Z" }, { "cucop_code": "25401-6575", "description": "080.709.0378 PIPETAS PIPETA SEROLOGICA DE PLASTICO ESTERIL LIBRE DE PIROGENOS DESECHABLE CON TAPON DE SEGURIDAD (ALGODON) EN EMPAQUE INDIVIDUAL. PARA PIPETOR AUTOMATICO. PARA VOLUMENES: 10 ML. GRADUACION. 10 ML EN 1/10 CAJA CON 200 PIEZAS.", "priced_items": 9, "units": [ { "n": 9, "max": 781.5, "min": 4.17, "p10": 4.17, "p50": 54, "p90": 631.5, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 4, "p50": 44.85 }, "2024": { "n": 1, "p50": 399.5 }, "2025": { "n": 3, "p50": 4.17 }, "2026": { "n": 1, "p50": 594 } }, "refreshed_at": "2026-09-18T22:38:19.421Z" }, { "cucop_code": "25401-6576", "description": "080.709.0386 PIPETAS PIPETA SEROLOGICA DE PLASTICO ESTERIL LIBRE DE PIROGENOS DESECHABLE CON TAPON DE SEGURIDAD (ALGODON) EN EMPAQUE INDIVIDUAL. PARA PIPETOR AUTOMATICO. PARA VOLUMENES: 25 ML. GRADUACION. 25 ML EN 1/10 CAJA CON 200 PIEZAS.", "priced_items": 11, "units": [ { "n": 11, "max": 3190, "min": 1.14, "p10": 1.14, "p50": 95.67, "p90": 2640, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 1, "p50": 2640 }, "2024": { "n": 1, "p50": 1007.83 }, "2025": { "n": 8, "p50": 6.73 }, "2026": { "n": 1, "p50": 292.66 } }, "refreshed_at": "2026-09-18T22:38:19.421Z" }, { "cucop_code": "25501-0145", "description": "CAJA / CONTENEDOR / EMBALAJE DE MUESTRAS", "priced_items": 168, "units": [ { "n": 165, "max": 95663, "min": 4.22, "p10": 39.17, "p50": 826.14, "p90": 5337.392, "unidad": "PIEZA" }, { "n": 3, "max": 92.6, "min": 23.87, "p10": 37.496, "p50": 92, "p90": 92.48, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 6, "p50": 603.45 }, "2024": { "n": 83, "p50": 690 }, "2025": { "n": 50, "p50": 805.675 }, "2026": { "n": 29, "p50": 1285 } }, "refreshed_at": "2026-09-18T22:38:31.345Z" }, { "cucop_code": "25501-0031", "description": "PIPETA", "priced_items": 1924, "units": [ { "n": 1822, "max": 118729.5, "min": 0.968, "p10": 72, "p50": 347.75, "p90": 3001.95, "unidad": "PIEZA" }, { "n": 96, "max": 26000, "min": 53, "p10": 156.475, "p50": 663.665, "p90": 2890, "unidad": "UNIDAD" }, { "n": 4, "max": 592313.78, "min": 3193.1, "p10": 29336.048, "p50": 161547.435, "p90": 484447.229, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 677, "p50": 417.23 }, "2024": { "n": 445, "p50": 445.5 }, "2025": { "n": 393, "p50": 317.74 }, "2026": { "n": 409, "p50": 270 } }, "refreshed_at": "2026-09-22T21:45:17.601Z" }, { "cucop_code": "29501-0005", "description": "ACCESORIOS DE EQUIPO E INSTRUMENTAL MEDICO Y DE LABORATORIO", "priced_items": 15662, "units": [ { "n": 15067, "max": 8167500, "min": 0.33, "p10": 88, "p50": 1740, "p90": 33510.672, "unidad": "PIEZA" }, { "n": 459, "max": 335230.5, "min": 1, "p10": 16.74, "p50": 303, "p90": 6375.468, "unidad": "UNIDAD" }, { "n": 73, "max": 14562073.76, "min": 80.4, "p10": 643.4, "p50": 18225.87, "p90": 1205240.8, "unidad": "SERVICIO" }, { "n": 22, "max": 474137.5, "min": 2532, "p10": 8321.258, "p50": 35593.62, "p90": 296017.31, "unidad": "LOTE" }, { "n": 18, "max": 16913, "min": 38.75, "p10": 68.325, "p50": 3192.2, "p90": 10654.988, "unidad": "VOLTIOS POR METRO" }, { "n": 18, "max": 44693, "min": 2740, "p10": 5067.8, "p50": 34463, "p90": 36366, "unidad": "KILOGRAMO POR HORA" } ], "price_by_year": { "2023": { "n": 4483, "p50": 3000 }, "2024": { "n": 3938, "p50": 1380.75 }, "2025": { "n": 4818, "p50": 1396.305 }, "2026": { "n": 2423, "p50": 1650 } }, "refreshed_at": "2026-09-26T05:35:02.119Z" } ], "suppliers": [ { "slug": "abalat", "name": "ABALAT SA DE CV", "total_contracts": 813, "total_awarded_amount": "3536526936.33", "median_amount": "402897.00", "distinct_buyers": 36, "first_contract_at": "2023-01-01T00:00:00.000Z", "last_contract_at": "2026-10-01T00:00:00.000Z", "with_this_buyer": { "contracts": 110, "amount": "325439369.97" }, "refreshed_at": "2026-09-23T22:15:06.688Z" }, { "slug": "comercial-medica-arze", "name": "COMERCIAL MEDICA ARZE SA DE CV", "total_contracts": 64, "total_awarded_amount": "19052069.43", "median_amount": "91155.00", "distinct_buyers": 10, "first_contract_at": "2023-02-10T00:00:00.000Z", "last_contract_at": "2026-07-28T00:00:00.000Z", "with_this_buyer": { "contracts": 5, "amount": "528974.2" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "control-tecnico-y-representaciones", "name": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "total_contracts": 787, "total_awarded_amount": "337140271.04", "median_amount": "93129.67", "distinct_buyers": 73, "first_contract_at": "2023-01-23T00:00:00.000Z", "last_contract_at": "2026-09-25T00:00:00.000Z", "with_this_buyer": { "contracts": 49, "amount": "21600190.41" }, "refreshed_at": "2026-09-25T00:00:02.669Z" }, { "slug": "grupo-veromo", "name": "GRUPO VEROMO SA DE CV", "total_contracts": 104, "total_awarded_amount": "21152006.58", "median_amount": "102444.31", "distinct_buyers": 15, "first_contract_at": "2023-02-01T00:00:00.000Z", "last_contract_at": "2026-07-23T00:00:00.000Z", "with_this_buyer": { "contracts": 19, "amount": "4006425.39" }, "refreshed_at": "2026-09-17T00:43:15.210Z" }, { "slug": "proveedora-nacional-de-material-de-curacion", "name": "PROVEEDORA NACIONAL DE MATERIAL DE CURACION SA DE CV", "total_contracts": 444, "total_awarded_amount": "186279207.16", "median_amount": "95776.31", "distinct_buyers": 19, "first_contract_at": "2023-01-12T00:00:00.000Z", "last_contract_at": "2026-09-24T00:00:00.000Z", "with_this_buyer": { "contracts": 26, "amount": "19941970.13" }, "refreshed_at": "2026-09-23T22:45:05.554Z" }, { "slug": "sarstedt-mexico", "name": "SARSTEDT MEXICO S DE RL DE CV", "total_contracts": 7, "total_awarded_amount": "1675030.42", "median_amount": "254246.53", "distinct_buyers": 1, "first_contract_at": "2023-03-29T00:00:00.000Z", "last_contract_at": "2026-06-19T00:00:00.000Z", "with_this_buyer": { "contracts": 7, "amount": "1675030.42" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "silvera-ciencia-e-ingenieria", "name": "SILVERA CIENCIA E INGENIERIA SA DE CV", "total_contracts": 340, "total_awarded_amount": "81225169.30", "median_amount": "70854.54", "distinct_buyers": 41, "first_contract_at": "2023-03-10T00:00:00.000Z", "last_contract_at": "2026-09-15T00:00:00.000Z", "with_this_buyer": { "contracts": 22, "amount": "1295457.9" }, "refreshed_at": "2026-09-20T04:43:00.057Z" } ], "buyer": { "slug": "iner", "name": "INSTITUTO NACIONAL DE ENFERMEDADES RESPIRATORIAS ISMAEL COSÍO VILLEGAS", "total_procedures": 1667, "distinct_suppliers": 518, "procedures_by_type": { "LICITACIÓN PÚBLICA": 68, "ADJUDICACIÓN DIRECTA": 1509, "INVITACIÓN A CUANDO MENOS TRES PERSONAS": 86, "CONTRATO ESPECÍFICO DERIVADO DE ACUERDO MARCO": 4 }, "refreshed_at": "2026-09-25T01:30:04.361Z" } }, "alternates": [], "similar": [ { "numero_procedimiento": "aa-12-ncd-012ncd001-i-208-2025", "nombre_procedimiento": "REACTIVOS EXPERIMENTALES PARA CONTINUIDAD DE PROTOCOLOS DE INVESTIGACION", "dependencia": "INER", "siglas": "INER", "score": 0.11031151475378798, "anio_ejercicio": 2025, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2025-07-15T16:28:34.000Z", "ganador": "ABALAT SA DE CV", "ganador_slug": "abalat", "ganador_rfc_type": null, "ganadores": "10", "monto_mxn": "3307495.86" }, { "numero_procedimiento": "aa-12-ncd-012ncd001-i-141-2025", "nombre_procedimiento": "REACTIVOS PARA REALIZAR ANALISIS DE PRUEBAS DE ELISA", "dependencia": "INSTITUTO NACIONAL DE ENFERMEDADES RESPIRATORIAS ISMAEL COSÍO VILLEGAS", "siglas": "INER", "score": 0.13917713527815578, "anio_ejercicio": 2025, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2026-07-21T13:23:59.000Z", "ganador": "ADN ARTIFICIAL S DE RL DE CV", "ganador_slug": "adn-artificial", "ganador_rfc_type": null, "ganadores": "4", "monto_mxn": "96916.93" }, { "numero_procedimiento": "aa-12-ncd-012ncd001-i-159-2026", "nombre_procedimiento": "PROD. QUIMICOS BASICOS Y SUM. LAB. ABALAT. REQ. 3349", "dependencia": "INSTITUTO NACIONAL DE ENFERMEDADES RESPIRATORIAS ISMAEL COSÍO VILLEGAS", "siglas": "INER", "score": 0.14426785707473755, "anio_ejercicio": 2026, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2026-05-29T15:39:16.000Z", "ganador": "ABALAT SA DE CV", "ganador_slug": "abalat", "ganador_rfc_type": null, "ganadores": "1", "monto_mxn": "2638883.70" }, { "numero_procedimiento": "aa-12-ncd-012ncd001-i-215-2026", "nombre_procedimiento": "PRODUCTOS QUIMICOS BASICOS Y MATERIALES 2327 REQ 3471", "dependencia": "INSTITUTO NACIONAL DE ENFERMEDADES RESPIRATORIAS ISMAEL COSÍO VILLEGAS", "siglas": "INER", "score": 0.14783119274191747, "anio_ejercicio": 2026, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2026-06-08T09:57:50.000Z", "ganador": "QIAGEN MEXICO S DE RL DE CV", "ganador_slug": "qiagen-mexico", "ganador_rfc_type": null, "ganadores": "1", "monto_mxn": "137502.11" }, { "numero_procedimiento": "aa-12-nbv-012nbv001-i-206-2023", "nombre_procedimiento": "ESTUDIO DE MERCADO DE PARTIDAS DESIERTAS DE LA DIRECCIÓN DE INVESTIGACIÓN 2023", "dependencia": "INCAN", "siglas": "INCAN", "score": 0.1571025252342224, "anio_ejercicio": 2023, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2023-07-28T18:09:21.000Z", "ganador": "IMPORTADORA DE MATERIALES PARA LABORATORIOS DE BIOTECNOLOGIA SA", "ganador_slug": "importadora-de-materiales-para-laboratorios-de-biotecnologia", "ganador_rfc_type": null, "ganadores": "4", "monto_mxn": "477151.40" }, { "numero_procedimiento": "aa-12-nbv-012nbv001-n-180-2023", "nombre_procedimiento": "ADQUISICIÓN DE MATERIAL DE EXTRACCIÓN DE ÁCIDOS NUCLÉICOS Y PRUEBAS MOLECULARES", "dependencia": "INSTITUTO NACIONAL DE CANCEROLOGÍA", "siglas": "INCAN", "score": 0.1602461338043213, "anio_ejercicio": 2023, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2023-07-03T16:22:18.000Z", "ganador": "MEXICO BIOCARE REPRESENTANTE SA DE CV", "ganador_slug": "mexico-biocare-representante", "ganador_rfc_type": null, "ganadores": "15", "monto_mxn": "821916.19" } ] }