{ "html_url": "https://postor.com.mx/adjudicacion/aa-08-izc-008izc999-n-95-2023", "canonical": "https://postor.com.mx/adjudicacion/aa-08-izc-008izc999-n-95-2023", "id": "4c504e39f04f4d3e8583cb77ddd414e2", "procedure_number": "AA-08-IZC-008IZC999-N-95-2023", "file_number": "E-2023-00049831", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LAB.", "description": { "short": "Equipos especializados, sustancias y materiales químicos, físico químico o bioquímico, para proyectos de investigación científica y desarrollo tecnológico.", "detailed": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LABORATORIO PARA CAMPUS VERACRUZ DEL COLEGIO DE POSTGRADUADOS" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO", "moved_at": null }, "buyer": { "agency": "COLEGIO DE POSTGRADUADOS", "acronym": "COLPOS", "branch": "08 - AGRICULTURA Y DESARROLLO RURAL", "buying_unit": "DEPARTAMENTO DE ADQUISICIONES Y CONTRATOS", "requesting_unit": null, "requesting_group": "DEPARTAMENTO DE ADQUISICIONES Y CONTRATOS", "entity": null, "slug": "colpos", "unit_slug": "departamento-de-adquisiciones-y-contratos-008izc999" }, "classification": { "procedure_type": "ADJUDICACIÓN DIRECTA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "NACIONAL", "fiscal_year": 2023, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": "38", "exception_basis": "Art. 41 fr. XVII", "internal_control_number": "VER-2023-17", "supply_source_number": null }, "schedule": { "published_at": "2023-07-11T18:18:57.000Z", "clarification_meeting_at": null, "clarification_questions_deadline_at": null, "clarification_responses_deadline_at": null, "bid_opening_at": null, "award_at": null, "estimated_contract_at": "2023-07-14T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "locations": { "state_id": "30", "state": "VERACRUZ", "bid_opening": null, "award": null, "clarification_meeting": null, "site_visit": null, "work_site": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "financial_terms": { "currency": "MXN", "advance_percentage": "0", "supplier_percentage": null, "payment_method": "transferencia electrónica", "credit_condition": null, "payment_conditions": null, "financing_organization": null }, "evaluation": { "criterion": "BINARIO", "technical_points": null, "economic_points": null }, "guarantees": { "performance_required": false, "goods_or_services_required": false, "amount_percentage": null, "delivery_days": null, "term_months": null, "other_insurance_required": false, "other_insurance_description": null, "performance_reduction": null }, "participation": { "method": null, "joint": false, "msme_only": false, "social_witness": false, "multi_year": false, "open_contract": true, "consolidated_purchase": false, "external_credit": false, "simultaneous_supply": false, "subcontracting": null, "emergency": false, "proposal_language": "idioma data", "no_joint_participation_justification": null }, "execution": { "site_visit_required": null, "duration_days": null, "procurement_term": "Normal", "subcontracted_work": null, "deadline_justification": null }, "lots": [ { "number": "1", "name": "PARTIDA SOLA", "description": "PARTIDA SOLA", "requirement_group_id": "1", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "1-METHYLBUTYL ACETATE, 100 GRAMOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "2", "cucop_code": "25101-0038", "specific_item_code": "25101", "cucop_description": "RESINAS QUIMICAS", "description": "ACCESS RT-PCR SYSTEM KIT DE 500 MUESTRAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "3", "cucop_code": "25101-0039", "specific_item_code": "25101", "cucop_description": "SUSTANCIAS QUÍMICAS", "description": "ACETATO DE SODIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "4", "cucop_code": "25101-0040", "specific_item_code": "25101", "cucop_description": "SULFATO DE AMONIO", "description": "ACETATO DE SODIO R.A, CRISTAL 2.5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "5", "cucop_code": "25101-0041", "specific_item_code": "25101", "cucop_description": "HULE SINTETICO Y ELASTOMEROS", "description": "ACETONA =99.5% 4 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "6", "cucop_code": "25101-0042", "specific_item_code": "25101", "cucop_description": "PASTA AL SULFATO", "description": "ACETONA GARRAFA 20 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "7", "cucop_code": "25101-0043", "specific_item_code": "25101", "cucop_description": "PASTA DE BAGAZO VISCOSA", "description": "ÁCIDO ACÉTICO AL 98 % PRESENTACIÓN DE 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "8", "cucop_code": "25101-0044", "specific_item_code": "25101", "cucop_description": "PASTA MECANICA", "description": "ÁCIDO ACÉTICO GLACIAL PRESENTACIÓN DE 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "9", "cucop_code": "25101-0046", "specific_item_code": "25101", "cucop_description": "PULIMENTOS Y LUSTRADORES", "description": "ÁCIDO ANHIDRIDO ACÉTICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "10", "cucop_code": "25101-0046", "specific_item_code": "25101", "cucop_description": "PULIMENTOS Y LUSTRADORES", "description": "ÁCIDO CLORHIDRICO GRADO ANALITICO 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "11", "cucop_code": "25101-0047", "specific_item_code": "25101", "cucop_description": "SULFATO DE ALUMINIO", "description": "ÁCIDO CLORHIDRICO GRADO REACTIVO DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "12", "cucop_code": "25101-0048", "specific_item_code": "25101", "cucop_description": "ABRASIVOS", "description": "ÁCIDO FOSFOMOLIBDICO PRESENTACIÓN DE 500 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "13", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ÁCIDO FOSFOWOLFRÁMICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "14", "cucop_code": "25101-0050", "specific_item_code": "25101", "cucop_description": "DESEMULSIONANTE", "description": "ÁCIDO HEXANÓICO DE 1 KILO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "15", "cucop_code": "25101-0051", "specific_item_code": "25101", "cucop_description": "ETHER", "description": "ÁCIDO LACTICO AL 88% PRESENTACIÓN 1 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "16", "cucop_code": "25101-0052", "specific_item_code": "25101", "cucop_description": "GLICERINA", "description": "ÁCIDO NÍTRICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "17", "cucop_code": "25101-0053", "specific_item_code": "25101", "cucop_description": "POLIURETANO", "description": "ÁCIDO SULFÚRICO CONCENTRADO PRESENTACIÓN 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "18", "cucop_code": "25101-0054", "specific_item_code": "25101", "cucop_description": "RODAMINA", "description": "ÁCIDO SULFURICO GRADO ANALITICO 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "19", "cucop_code": "25101-0055", "specific_item_code": "25101", "cucop_description": "SAFRANINA", "description": "ÁCIDO SULFURICO GRADO REACTIVO 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "20", "cucop_code": "25101-0056", "specific_item_code": "25101", "cucop_description": "SULFATO DE SODIO", "description": "ÁCIDO SULFURICO GRADO REACTIVO DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "21", "cucop_code": "25101-0057", "specific_item_code": "25101", "cucop_description": "SULFATO DE ZINC", "description": "ÁCIDO VALÉRICO DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "22", "cucop_code": "25101-0058", "specific_item_code": "25101", "cucop_description": "SULFITO DE BISMUTO", "description": "AGAR BACTERIOLOGICO FRASCO DE 250 GRS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "23", "cucop_code": "25101-0059", "specific_item_code": "25101", "cucop_description": "SULFURO DE SODIO", "description": "AGAR BACTERIOLÓGICO. FRASCO CON 500 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "24", "cucop_code": "25101-0060", "specific_item_code": "25101", "cucop_description": "TIOSULFATO DE SODIO", "description": "AGAR CEREBRO CORAZON FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "25", "cucop_code": "25101-0061", "specific_item_code": "25101", "cucop_description": "CLORURO DE POTASIO", "description": "AGAR MÉTODOS ESTANDAR FRASCO 450G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "26", "cucop_code": "25101-0062", "specific_item_code": "25101", "cucop_description": "AGUA DESIONIZADA", "description": "AGAR NUTRITIVO FRASCO (450GR)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "27", "cucop_code": "25101-0063", "specific_item_code": "25101", "cucop_description": "AGUA BIDESTILADA", "description": "AGAR PAPA DEXTROSA PDA FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGAROSA ULTRA PURA 100 GRAMOS. GRADO BIOLOGÍA MOLECULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "29", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA DESTILADA 20 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA DESTILADA BOTELLAS DE 1 LITRO CADA UNO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA DESTILADA GALÓN DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA DESTILADA GARRAFÓN DE 19 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA OXIGENADA 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL AMÍLICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL ETILICO AL 96% CON 20 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL ISOAMILICO GRADO ACS DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL ISOPROPILICO GRADO ACS DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALCOHOL METILICO GRADO ACS DE 4 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ALGINATO DE SODIO EN POLVO GRADO ALIMENTICIO PRESENTACIÓN DE 1 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ANHIDRIDO ACÉTICO AL 99% DE PUREZA PRESENTACIÓN DE 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BACTOZOLTM. KIT PARA AISLACIÓN DE ADN BACTERIANO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BPW AGUA PEPTONADA TAMPONADA 500 GRS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER DE CARGA PARA ELECTROFORESIS DE 1 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "44", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER PH 10 DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "45", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER PH 4 DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "46", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BUFFER PH 7 DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CARBON ACTIVADO 100G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "48", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CARBORUMDUM -CARBURO DE SILICONA CALIBRE FINO FRASCO DE 250 GR (SILICON CARBIDE -400 MESH PARTICLE SIZE, =97.5% SINÓNIMOS: CARBON SILICIDE, CARBORUNDUM, METHANIDYLIDYNESILANYLIUM, SILICON MONOCARBIDE 250 G)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CGINT GGCCTCCCGCCTCCGGGCGG 25 NM ESTÁNDAR DESALADO 20", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CGINT: GGCCTCCCGCCTCCGGGCGG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "51", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLOROFORMO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE CALCIO ANHÍDRO ACS DE 500 GRS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "53", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE HIERRO (III) PRESENTACIÓN DE 500 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "54", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE POTASIO (KCL) FRASCO DE 100 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO DE POTASIO R.A. 2.5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "56", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CLORURO MERCÚRICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLORANTE PARA TEÑIR ÁCIDOS NUCLEICOS GEL RED® 10 000 X 0.5 ML.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "58", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "COLORANTE PARA TEÑIR GELES DE ELECTROFORESIS (SUSTITUTO DE BROMURO DE ETIDIO) DE 500 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "D-GLUCOSA ANHIDRA ACS (DEXTROSA) PARA MICROBIOLOGÍA (MEDIO DE CULTIVO). FRASCO DE 250 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "60", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "DIHIDRÓGENO FOSFATO DE POTASIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "61", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA DNA POLIMERASA GOTAQ® FLEXI DNA. PARA AMPLIFICACIÓN DE ADN POR PCR. 500 UNIDADES.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ENZIMA TAQ POLIMERASA. 500 UNIDADES. LA BIOLASA (ADN POLIMERASA)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESCALERA BAJA PCR 20 PB, PARA ELECTROPHORESIS DE FRAGMNETOS DE PCR CON 40 µG.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTER DEL ÁCIDO 2-AMINOETILDIFENIL BÓRICO (AEDBE) PRESENTACIÓN 5 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ETHYL 4-[BENZYL(METHYL)AMINO]BUTANOATE PH017049-1G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXTRACTO DE LEVADURA. MEDIO DE CULTIVO BACTERIOLÓGICO. FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXTRACTO DE LEVADURA. MEDIO DE CULTIVO PARA MICROBIOLOGÍA. FRASCO DE 500 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EXTRACTO DE TÉ VERDE ESTANDARIZADO EN CAPSULAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FENOLFTALEÍNA 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "FOSFATO DE CALCIO CA3(PO4)2 (FOSFATO TRICÁLCICO). FRASCO DE 250 G.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "71", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "GLICEROL PURO GRADO REACTIVO PRESENTACIÓN 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "72", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEXANO GA LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "73", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEXYL ACETATE, 25 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "74", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓXIDO DE POTASIO GRADO ANALÍTICO FRASCO DE 500 GRAMOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓXIDO DE SODIO GRADO ANALÍTICO FRASCO DE 500 GRAMOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDROXIDO DE SODIO GRADO REACTIVO 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "77", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓXIDO DE SODIO PRESENTACIÓN 500 GR POLVO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "78", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ISODINE FRASCO (500 ML)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "79", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ITS 1: TCCGTAGGTGAACCTGCGG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "80", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ITS 4: TCCTCCGCTTATTGATATGC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "81", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ITS1 TCCGTAGGTGAACCTGCGG 25 NM ESTÁNDAR DESALADO 19", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "82", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ITS4 TCCTCCGCTTATTGATATGC 25 NM ESTÁNDAR DESALADO 20", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "83", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT CEC-CI (COLIFORM&E. COLI COLOR INDICATOR)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "84", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "KIT DE LIMPIEZA DE GEL Y PCR QIAQUICK (100). PARA PURIFICACIÓN DE FRAGMENTOS DE PCR Y EXTRACCIONES EN GEL DE 100 REACCIONES (AL MENOS 80-100 REACCIONES EN GEL O 100 PCR).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "85", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "LINALOOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "86", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR PARA ADN. BH 50BP DNA LADDER RTU. (17 BANDS, 50-1,500BPS) CODIGO DM012-R500. 500 MICROLITROS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "87", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MARCADOR DE PESO MOLECULAR PARA GELES DE ADN: BH 100 BP DNA LADDER RTU. DM001-R500. 500 MICROLITROS (11 BANDS, 100-1,500BPS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "88", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO BASAL DE MURASHIGE Y SKOOG 50 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "89", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO B-KING PARA CULTIVO DE BACTERIAS 500 GRS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "90", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO PDA. FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "91", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO DE CULTIVO TCBS. PARA CRECIMIENTO DE VIBRIOS. FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "92", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MEDIO PDA MCD-LAB CAT. 7041", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "93", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL AL 99% DE PUREZA PRESENTACIÓN 20 LITROS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "94", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "MOLIBDATO DE SODIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "95", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "N-BUTANOL PRESENTACIÓN DE 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "96", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NINHIDRINA PRESENTACIÓN DE 10 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "97", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO BÁSICO DE BISMUTO (III) PRESENTACIÓN DE 100 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "98", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE AMONIO GRADO REACTIVO ANALÍTICO DE 2.5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "99", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE BISMUTO PENTAHIDRATADO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "100", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE CALCIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "101", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE POTASIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "102", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE POTASIO (KNO3). FRASCO DE 100 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "103", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE POTASIO GRADO REACTIVO ANALÍTICO DE 2.5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "104", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NITRATO DE POTASIO PRESENTACIÓN EN FRASCO DE 1 KG EN POLVO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "105", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PCR CORE KIT WITH TAQ DNA POLYMERASE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "106", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEPTONA EXTRACTO DE CARNE FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "107", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PEROXIDO DE HIDROGENO 30% GRADO REACTIVO 4 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "108", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PÉROXIDO DE HIDRÓGENO AL 30% RA, PRESENTACIÓN DE 1 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "109", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PHYTAGEL FRASCO (250G)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "110", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "POLY(VINYLPOLYPYRROLIDONE) 100 GRS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "111", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PÚRPURA DE BROMOCRESOL FRASCO DE 250 G PARA USO MICROBIOLÓGICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "112", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QUELATO DE HIERRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "113", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QUICK-RNA MICROPREP ZYMO RESEARCH KIT DE 200 MUESTRAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "114", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "QUITOSANO EN POLVO DE ALTA DENSIDAD GRADO ALIMENTICIO PRESENTACIÓN DE 1 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "115", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO FOLIN-CIOCALTEU FENOL REAGENT, \"N 500 ML,", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "116", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA AMONIO RANGO MEDIO HI93715-01 CAJA CON 100 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "117", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA FOSFORO RANGO MEDIO HI93706A-0 CAJA CON 100 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "118", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA FOSFORO RANGO MEDIO HI93706B-0 CAJA CON 100 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "119", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA POTASIO RANGO MEDIO HI93750A-0 CAJA CON 100 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "120", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA POTASIO RANGO MEDIO HI93750B-0 CAJA CON 100 SOBRES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "121", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVO PARA SULFATO RANGO MEDIO HI93751-01 CAJA CON 100 PBAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "122", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVOS PARA FÓSFORO , PAQUETE CON 100 REACTIVOS HI93706A-0", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "123", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVOS PARA FÓSFORO , PAQUETE CON 100 REACTIVOS HI93706B-0", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "124", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "REACTIVOS PARA NITRITOS , PAQUETE CON 100 REACTIVOS HI93708-01", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "125", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ROJO CONGO 25 G G PARA USO MICROBIOLÓGICO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "126", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "RVS 12.75G RAPPAPORT-VASSILIADIS-SOYA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "127", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SACAROSA FRASCO DE 450G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "128", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SET DE DNTPS PARA PCR POR SEPARADO. 4 X 25 UMOL (4X250UL)/ 4 X 100 UMOL (4X1ML) / 4 X 100 UMOL (4X4X250UL) / 4 X 500 UMOL (4X5X1 ML) / 4 X 1000 UMOL (4×10 ML). EL SET CONSISTE EN CUATRO SOLUCIONES 100 MM SEPARADAS DE: DATP, DCTP, DGTP Y DTTP RESPECTIVAMENTE. ULTRAPURO: >99% TRIFOSFATO POR HPLC.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "129", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SILICON STANDARD PARA AAS TRACECERT 1000 MG/L SI IN NAOH", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "130", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SODIO HEXAMETAFOSFATO 65-70% DE 5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "131", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SODIUM CARBONATE, ANHYDROUS, POWDER, FRASCO 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "132", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SODIUM CARBONATE, ANHYDROUS, POWDER, FRASCO 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "133", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCION DE BUFFER PH CONTROL PH 10 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "134", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCION DE BUFFER PH CONTROL PH 4. 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "135", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCION DE BUFFER PH CONTROL PH 7 500 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "136", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "STANDAR CONDUCTIVIDAD ELECTRICA 1413 µS/CM 500ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "137", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO CÚPRICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "138", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE CALCIO (CASO4). FCO DE 250 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "139", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE COBRE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "140", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE MAGNESIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "141", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE MANGANESO ANHIDRO MNSO4 FCO DE 100 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "142", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE POTASIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "143", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SULFATO DE ZINC", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "144", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TARTRATO DE SODIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "145", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRICLORURO FÉRRICO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "146", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIPTONA (DIGERIDO PANCREÁTICO DE CASEÍNA) 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "147", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TRIPTONA. MEDIO DE CULTIVO BACTERIOLÓGICO. FRASCO DE 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "148", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 20 (POLISORBATO 20) DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "149", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TWEEN 20 (POLISORBATO 20) DE 1 LITRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "150", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "WP200I GAMMA IRRAD COLILERT 100ML 200PK(AMPOLLETAS PARA DETECCIÓN DE COLIFORMES Y E. COLI) PARA 100 ML. AYAG981297300. 12352200.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "151", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "WPSE020I GAMMA IR PSEUDALERT 100ML 20PK. AYAG981807600. 12352200", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "152", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "YODURO DE POTASIO PRESENTACIÓN DE 100 GR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "153", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ZYMOBIOMICS DNA MICROPREP KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "154", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ZYMOBIOMICS DNA MINIPREP KIT (LYSIS TUBES) 50 PREPS. D4300", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "155", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO CLORHÍDTICO VALORADO 0.1 N PRESENTACIÓN 2 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "156", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HIDRÓXIDO DE SODFIO LENTEJAS J.T. BAKER PRESENTACIÓN 5 KG", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "157", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACETONITRILO PRESENTACIÓN 2 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "158", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "METANOL PRESENTACIÓN 2 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "159", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CITRATO DE TRISÓDICO DIHIDRATO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "160", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "L-AMINOÁCIDOS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "161", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTÁNDAR DE AMINOÁCIDO PRESENTACIÓN 5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "162", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "TIODIGLICOL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "163", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NORLEUCINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "164", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "NORVALINA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "165", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "CATALIZADORES KJELDAHL PARA LA DETECCIÓN DEL NITRÓGENO PRESENTACIÓN 500 G", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "166", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ÁCIDO SULFÚRICO CONCENTRADO PRESENTACIÓN 4L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "167", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "HEXANO GRADO REACTIVO PRESENTACIÓN 20 L", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "168", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOL. ESTANDAR DE FOSOFORO 100 ML. 170340-0100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "169", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ESTANDAR DE CALCIO 100 ML. 119778-0100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "170", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACIDO GIBERELICO -BIOGIB 10GR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "171", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ACIDO FOSFORICO RA. 2.5 LTS. 0260-05", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "172", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BICARBONATO DE SODIO PVO. 500 GRS. 3506-01", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "173", "cucop_code": "25501-0002", "specific_item_code": "25501", "cucop_description": "APARATO PARA DEMOSTRAR LA CONSERVACION DE LA ENERGIA", "description": "APARATO DE FILTRACION CAP. ENBUDO 300 ML. CAP MATRAZ 1000 ML. MEMBRANA 47 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "174", "cucop_code": "25501-0002", "specific_item_code": "25501", "cucop_description": "APARATO PARA DEMOSTRAR LA CONSERVACION DE LA ENERGIA", "description": "APARATO DE FILTRACION CAP. ENBUDO 300 ML. CAP MATRAZ 500 ML. MEMBRANA 47 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "175", "cucop_code": "25501-0065", "specific_item_code": "25501", "cucop_description": "BANDEJA", "description": "BANDEJAS PARA CUANTIFICACIÓN DE BACTERIAS UTILIZANDO LOS KITS RÁPIDOS DE IDEXX CON 97 POCILLOS PAQUETE DE 100 PIEZAS NO. DE PARTE 98-21675-00 (100-PACK STERILE 97-WELL QUANTI TRAY/200(PAQUETE DE 100 CHAROLAS QUANTI-TRAY/200 CADA UNA DE 97 POZOS) AYAG982167500 ( 41122800))", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "176", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 15.9X8 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "177", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 22.2X8 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "178", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 38.1X8 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "179", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 50.8X 8MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "180", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA MICRO SIN ANILLO RECUBIERTA DE TEFLON 10X3 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "181", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "BARRA MAGNETICA MICRO SIN ANILLO RECUBIERTA DE TEFLON 7X2 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "182", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "BIORREACTORES BIT CON ESPONJA DE 1 LT QUE CONTIENE CADA UNO LO SIGUIENTE: 2 FRASCO DE VIDRIO 1.0 LT. 2 TAPA DE PLASTICO ESTERILIZABLE C/2 PERFORACIONES 2 EMPAQUE PLANO DE SILICON DE 70X7X1MM LUZ. 55 MM 4 CONECTOR PASAMURO ESTERILIZABLE DE PLASTICO 8 MM. 8 EMPAQUE PLANO D/SILICON DE 16X5X2MM LUZ 8 MM 2 FILTRO HIDROFOBICO ESTERILIZABLE 50 MM D/DIAMY 0.2 UM 2 ABRAZADERA DE MUELLE PARA MANGUERA 8.9 - 9.3 MM 4 ABRAZADERA DE ALAMBRE PARA MANGUERA 9.4 -10.4 MM 0.7 MANGUERA ESTERILIZABLE DE SILICÓN PLATINIZADA 6 MM. DIAM. INT. 1 TUBO DE ACERO INOX DE 8 MM D/DIAM. DE 13 CM. C/ARANDELA 1", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "183", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "BLOQUE PARA BAÑO SECO ANALOGO PARA 20 TUBOS DE 13MM , 2.0 ML ( 9 CM X 7.5 CM X 4 CM ALTO. APROX.)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "184", "cucop_code": "25501-0132", "specific_item_code": "25501", "cucop_description": "TUBO SALOMÓNICO", "description": "BOTELLAS PLÁSTICAS CON MARCA DE LÍNEA A UN VOLUMEN DE 100 ML PAQUETE CON 200 PIEZAS (200-PACK 120ML VESSEL WITH 100ML) AYAG980615900 (41115822)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "185", "cucop_code": "25501-0130", "specific_item_code": "25501", "cucop_description": "BULBO DE LATEX", "description": "BULBO DE HULE 2 ML DE CAPACIDAD 50 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "186", "cucop_code": "25501-0122", "specific_item_code": "25501", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "description": "BURETA 100 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "187", "cucop_code": "25501-0122", "specific_item_code": "25501", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "description": "BURETA 250 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "188", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJA DE PETRI VIDRIO, 6 CM DIAMETRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "189", "cucop_code": "25501-0101", "specific_item_code": "25501", "cucop_description": "CAJAS PLASTIFICADAS", "description": "CAJA PARA 100 PORTAOBJETOS COLOR NEGRA CON CORCHO- MEDIDAS 208X175X34 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "190", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJA PETRI DE PLASTICO ESTERIL 90 X 15 MM DESECHABLES INDIVIDUALES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "191", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJAS DE PETRI DE POLIESTIRENO DESECHABLES DE 90 X 15 MM, CON 4 DIVISIONES. ESTÉRILES. CAJA DE 540 PZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "192", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJAS DE PETRI DE POLIESTIRENODESECHABLES DE 90 X 15 MM. SIN DIVISION. ESTÉRILES. CAJA DE 540 PZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "193", "cucop_code": "25501-0005", "specific_item_code": "25501", "cucop_description": "CAJA PETRI", "description": "CAJAS DE PETRI PLÁSTICAS ESTÉRILES 90 X 15 CM.PAQUETE DE 500 PZAS. PARA CRECIMIENTO MICROBIANO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "194", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "COLILERT/COLILERT-18 COMPARATOR. PREDISPE. AYAG980922700.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "195", "cucop_code": "25501-0107", "specific_item_code": "25501", "cucop_description": "CRONOMETRO", "description": "CONÓMETRO CON 4 CANALES Y ALARMA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "196", "cucop_code": "25501-0009", "specific_item_code": "25501", "cucop_description": "CRISOL", "description": "CRISOL DE PORCELANA FORMA ALTA CON TAPA 100 ML COORSTEK", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "197", "cucop_code": "25501-0107", "specific_item_code": "25501", "cucop_description": "CRONOMETRO", "description": "CRONÓMETRO DE FACIL USO 1 S A 99 MIN, 59 S.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "198", "cucop_code": "25501-0011", "specific_item_code": "25501", "cucop_description": "CUBETA DESECHO", "description": "CUBETA DE CUARZO UV-VIS 10 MM, 3.5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "199", "cucop_code": "25501-0011", "specific_item_code": "25501", "cucop_description": "CUBETA DESECHO", "description": "CUBETA DE CUARZO UV-VIS 5 MM 1.7 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "200", "cucop_code": "25501-0011", "specific_item_code": "25501", "cucop_description": "CUBETA DESECHO", "description": "CUBETAS DE VIDRIO PARA H1832XX SERIE. CAJA CON 4 PZA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "201", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "DATA LOGGER (REGISTRADOR DE DATOS) DE TEMPERATURA/HUMEDAD RELATIVA U23-001", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "202", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "ELECTRODO C.E. HI76310", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "203", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "ELECTRODO PH HI1110", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "204", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "ELECTRODO PH HI1131", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "205", "cucop_code": "25501-0088", "specific_item_code": "25501", "cucop_description": "REACTIVOS QUIMICOS PARA USO DE LABORATORIO DE MEDICION", "description": "ELECTROLYTE SOLUCION HI7071", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "206", "cucop_code": "25501-0016", "specific_item_code": "25501", "cucop_description": "EMBUDO SEPARADOR", "description": "EMBUDO DE VIDRIO TALLO CORTO ANGULO 58*", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "207", "cucop_code": "25501-0123", "specific_item_code": "25501", "cucop_description": "EXTRACTOR SOXHLET", "description": "EQUIPO DE EXTRACCION SOXHLET MATRAZ 250 ML.EBULLICION, CONDENSADOR ALLIHN, JUNTA INFERIOR 24/40, SUPERIOR 45/50, ALTURA APROX. 711 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "208", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "EQUIPO DE ULTRASONIDO PORTATIL. PUEDE SER MINDRAY DP10H CON 1 TRANSDUCTOR LINEAL.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "209", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "ESPATULA TIPO HEYMAN UN EXTREMO PLANO Y OTRO ACANALADO LONGITUD 150 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "210", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "FRASCO PARA DILUCIÓN DE LECHE BOCA ANCHA DE VIDRIO DE BOROSILICATO, CON AFORO A 99 ML, INCLUYA TAPA FENÓLICA ROSCADA Y SELLO DE HULE ESTERILIZABLE EN AUTOCLAVE. CAPACIDAD DE 160 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "211", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "FRASCOS ÁMBAR DE 50 ML CON TAPA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "212", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "FRASCOS SELLADOS HERMÉTICAMENTE CON ARILLO DE GOMA DE 800 ML-1000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "213", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "FUENTE DE PODER PARA CAMARA DE ELECTROFORESIS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "214", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA ENFRIADORA PARA 32 TUBOS TRUE NORTH MINI-COOLER, 32 POCILLOS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "215", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA ENFRIADORA PARA 96 TUBOS DE 0.2 ML 120729 PCR COOLER, 96 POCILLOS)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "216", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA PARA CONGELACIÓN . PARA LA PROTECCIÓON DE ENZIMAS, CÉLULAS, REACTIVOS Y SOLUCIONES QUE DEBEN MANTENERSE A BAJA TEMPERATURA (-20 C) MIENTRAS SE UTILIZAN EN LABORATOIRO. CAPACIDAD DE 18 VIALES DE 0.2 A 2.0 ML. DE POLICARBONATO CON TAPA DE ROSCA DE POLIETILENO. MEDIDAS APROXIMADAS DE 117 DE DIÁMETRO X 86 MM DE ALTURA, O BIEN DE 243 MM LARGO X 157 MM DE ANCHO X 146 MM DE ALTO. CIRCULAR O RECTANGULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "217", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA PARA TUBOS 4 WAY RACK X PIEZA. PARA TUBOS DE 50, 15, 1.5/2.0 Y 0.5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "218", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA PARA TUBOS CONICOS TUBOS DE 50 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "219", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA PARA TUBOS ROTABLE. CUENTE CON 4 MÓDULOS GIRATORIOS INTERCONECTADOS CON CAPACIDAD PARA DIFERENTES TUBOS CÓNICOS DE 15- 50 ML Y 1.5 ML. ESTERIZABLE EN AUTOCLAVE. CADA MÓDULO DE DIFEREENTE COLOR: VIOLETA, AMARILLO, AZUL Y VERDE.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "220", "cucop_code": "25501-0126", "specific_item_code": "25501", "cucop_description": "REJILLA PORCELANICO", "description": "GRADILLA ROTATORIA CAPACIDAD 10 A 17 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "221", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "HEMATOCÍMETRO O CÁMARA DE NEUBAUER. PARA DETERMINAR LA CONCENTRACIÓN DE CÉLULAS EN UN MEDIO LÍQUIDO. INCLUYA DOS PORTAOBJETOS PARA EL HEMATOCITÓMETRO CON ESPESOR DE 0.4 MM. 0.100 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "222", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "JUEGO DE MICROPIPETAS FINNPIPETTE FINNP70700 CON 4 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "223", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "KIT SINGLE PATH SAMONELLA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "224", "cucop_code": "25501-0102", "specific_item_code": "25501", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "description": "LUXÓMETRO O EXPOSÍMETRO. MIDA MÍNIMO DE 0 A 50,000 LUXES. CUENTE CON INDICADOR DE BATERÍA BAJA Y TEMPORIZADOR PARA APAGADO AUTOMÁTICO.INCLUYA BATERÍA Y ESTUCHE.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "225", "cucop_code": "25501-0079", "specific_item_code": "25501", "cucop_description": "PAÑUELOS ANTIESTATICOS", "description": "MASCARA PARA GASES (GRANDE)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "226", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRACES ERLENMEYER DE 500 MILILITROS TIPO A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "227", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "228", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 25 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "229", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 5 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "230", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 50 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "231", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "232", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 1000ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "233", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 100ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "234", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 20 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "235", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 2000ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "236", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 30 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "237", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 300ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "238", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ AFORADO 40 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "239", "cucop_code": "25501-0024", "specific_item_code": "25501", "cucop_description": "MATRAZ", "description": "MATRAZ ESMERILADO SOXHLET 250 ML, 24/40", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "240", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "MEDIDOR DE CALIDAD DE AGUA PH", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "241", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "MEDIDOR DE PH, TEMPERATURA, ACIDEZ Y ALCALINIDAD PARA SUELO.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "242", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "MICROTUBOS COLOR AMBAR DE POLIPROPILENO PARA MICROCENTRÍFUGA DE 1.5 ML. LIBRES DE DNASAS, RNASAS E INHIBIDORES DE PCR. BOLSA DE 500 A 1000 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "243", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "MICROTUBOS TRANSPARENTE DE POLIPROPILENO PARA MICROCENTRÍFUGA DE 1.5 ML. LIBRES DE DNASAS, RNASAS E INHIBIDORES DE PCR. BOLSA DE 1,000 PZAS. PARA EXTRACCIÓN DE ADN. BIOLOGÍA MOLECULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "244", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 0.1-2.5 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "245", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 1000-10000 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "246", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 100-1000 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "247", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 20-200 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "248", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 5-10 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "249", "cucop_code": "25501-0026", "specific_item_code": "25501", "cucop_description": "MICROPIPETAS", "description": "MICROPIPETA VOL VARIABLE 10-100 µL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "250", "cucop_code": "25501-0027", "specific_item_code": "25501", "cucop_description": "MORTERO DE LABORATORIO", "description": "MORTERO DE PORCELANA CON PISTILO DE 125 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "251", "cucop_code": "25501-0027", "specific_item_code": "25501", "cucop_description": "MORTERO DE LABORATORIO", "description": "MORTERO DE PORCELANA CON PISTILO DE 65 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "252", "cucop_code": "25501-0027", "specific_item_code": "25501", "cucop_description": "MORTERO DE LABORATORIO", "description": "MORTERO CON PISTILO DE PORCELANA CON LABIO DE 50 ML (MEDIDAS 70 MM X 47 MM DE DIÁMETRO INTERNO).", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "253", "cucop_code": "25501-0027", "specific_item_code": "25501", "cucop_description": "MORTERO DE LABORATORIO", "description": "MORTERO CON PISTILO DE PORCELANA CON LABIO DE 65 O 80 ML (MEDIDASAPROX. 80 MM X 53 MM DE DIÁMETRO INTERNO)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "254", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "OWL A3-1 LARGE-GEL ELECTROPHORESISSYSTEMWELL-SUITED FOR PLANT GENOMICS STUDIES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "255", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PALL FILTROS ESTÉRILES ACRODISC™ PARA JERINGAS CON MEMBRANA SUPOR™ CON MEMBRANAS DE POLIESTERSULFONA (PES). PALL. CAT. 4611 (0,1 µM 25 MM). CAJA DE 50 PZAS.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "256", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO NO. 42 WHATMAN,DIÁMETRO 110MM, PAQUETE CON 100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "257", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL FILTRO WHATMAN NO. 1, DIAMETRO 110 MM CAJA CON 100", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "258", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PAPEL PARAFILM 100 MM X 75 M \"M\"SEALING", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "259", "cucop_code": "25501-0094", "specific_item_code": "25501", "cucop_description": "SENSOR OPTICO", "description": "PICNOMETRO CALIBRADO DE 50 ML. PICNÓMETROS SON FABRICADO EN VIDRIO SEGÚN LA NORMA ISO 3507. TANTO EL CUERPO COMO EL TAPÓN LLEVAN EL MISMO NÚMERO DE CÓDIGO DE IDENTIFICACIÓN. CALIBRADO JUNTO CON EL TAPÓN CON UNA PRECISIÓN DE 0,001 ML.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "260", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS 2 DEDOS CON NUEZ GIRATORIA, 12-45 MM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "261", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS DE DISECCION LARGAS DE 30CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "262", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS PARA PAPEL DE ACERO INOXIDABLE CON PUNTA CURVA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "263", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS PARA REFRIGERANTE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "264", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS PARA VASO CUBIERTA DE VINILO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "265", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS SENCILLA PARA BURETARECUBIERTA DE VINILO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "266", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PINZAS TIPO RELOJERO LARGAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "267", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETA DE VIDRIO DE 1100 MILILITROS PARA DETERMINAR TEXTURA DEL SUELO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "268", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETAS GRADUADAS DE VIDRIO DE 500 MILILITROS (ML)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "269", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETAS GRADUADAS DE VIDRIO, 10 ML , TIPO O CLASE \"A\"", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "270", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETAS GRADUADAS DE VIDRIO, 100 ML , TIPO O CLASE \"A\"", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "271", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETAS GRADUADAS DE VIDRIO, 25 ML , TIPO O CLASE \"A\"", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "272", "cucop_code": "25501-0080", "specific_item_code": "25501", "cucop_description": "PINZAS", "description": "PROBETAS GRADUADAS DE VIDRIO, 50 ML , TIPO O CLASE \"A\"", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "273", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS AMARILLAS DE 20 A 200 µL,PAQUETE CON 1000 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "274", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA AMARILLAS (20 A 200 UL) EN RACK ESTÉRILES DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS LA CAJA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "275", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA AZULES (1000 UL) EN CAJAS ESTÉRILES (RACK DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS TOTALES.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "276", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PUNTAS PARA MICROPIPETA BLACAS (0.5-10 UL) EN CAJAS ESTÉRILES (RACK DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS EN TOTAL.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "277", "cucop_code": "25501-0043", "specific_item_code": "25501", "cucop_description": "SOPORTE PARA LABORATORIO", "description": "SOPORTE UNIVERSAL CON VARILLA DE 60 CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "278", "cucop_code": "25501-0057", "specific_item_code": "25501", "cucop_description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "description": "TAPA P/ TUBO DE ENSAYE DEL Nº 9820", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "279", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOHIGRÓMETRO DIGITAL PARA INTERIOR Y EXTERIOR CON REGISTRO DE TEMPERATURA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "280", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOHIGRÓMETRO PARA INTERIOR Y EXTERIOR. PARA REGISTRO DE TEMPERATURA Y HUMEDAD. REGISTRE MÁXIMOS Y MÍNIMOS DE DICHAS VARIABLES.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "281", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMÓMETRO DE MERCURIO PARA LABORATORIO, FONDO AMARILLO. DE -20 A 110 C. DIVISIÓN DE UN GRADO. LONGITUD DE 322 MM. INMERSION TOTAL", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "282", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TÉRMOMETRO DE PERMACOLOR PARA LABORATORIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "283", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TÉRMOMETRO DE PERMACOLOR PARA LABORATORIO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "284", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOMETRO DE VIDRIO DE -10 A 260", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "285", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOMETRO DE VIDRIO DE -100 A 50", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "286", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOMETRO DE VIDRIO DE -20 A 250", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "287", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMOMETRO DE VIDRIO DE -50 A 50", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "288", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMÓMETRO INFRARRORO TIPO PISTOLA CON LASER", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "289", "cucop_code": "25501-0096", "specific_item_code": "25501", "cucop_description": "TERMOMETRO", "description": "TERMÓMETRO MÁXIMO MÍNIMO PARA INVERNADERO O JARDÍN, TEMPERATURAS MÁXIMAS Y MÍNIMAS, ACCESORIOS DE INVERNADERO PARA INTERIORES Y EXTERIORES", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "290", "cucop_code": "25501-0057", "specific_item_code": "25501", "cucop_description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "description": "TROMPA DE VACIO 6140-0010", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "291", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBO DE ENSAYE Nº 9820", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "292", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBO PARA DIGESTION LABCONCO 250ML, COD. 23030 Ó 23040. CAJA CON 25", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "293", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS DE ENSAYE DE VIDRIO DE BOROSILICATO (10X75 MM) PARA CULTIVO MICROBIOLÓGICO. AUTOCLAVABLES. SIN LABIO. QUÍMICA. CON ÁREA PARA MARCAR EN ESMALTE DE CERÁMICA BLANCA.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "294", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS DE FONDO PLANO DE 20 X 120 MM. DE FABRICACIÓN NACIONAL. 10 PZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "295", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS DE POLIPROPILENO CÓNICOS PLÁSTICOS DE 15 ML, GRADUADOS. TIPO FALCON. BOLSA DE 500 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "296", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS DE POLIPROPILENO CÓNICOS PLÁSTICOS DE 50 ML DE FONDO PLANO, GRADUADOS. TIPO FALCON. BOLSA DE 50 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "297", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS EPPENDORF DE 1.5 ML, PAQUETE CON 1000 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "298", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "TUBOS EPPENDORF DE 2 ML, PAQUETE CON 1000 PIEZAS", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "299", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO 100 ML TIPO A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "300", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 10 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "301", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 100 ML 1 CAJA CON 50", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "302", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 1000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "303", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 2000 ML", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "304", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 50 MILILITROS TIPO A", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "305", "cucop_code": "25501-0053", "specific_item_code": "25501", "cucop_description": "VASOS COMUNICANTES", "description": "VASOS DE PRECIPITADO DE 50 ML PAQUETE CON 50", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "306", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "VIALES AMBAR DE 5 ML CON TAPA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "307", "cucop_code": "25501-0133", "specific_item_code": "25501", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "description": "VIALES AMBAR DE 50 ML CON TAPA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "308", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "Y&M-CI(YEAST & MOLD COLOR INDICATOR)", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "309", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "YSI 1001 PH PROBE KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "310", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "YSI 1004 AMMONIUM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "311", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "YSI 1005 CHLORIDE", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "312", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "YSI 1006 NITRITE PROBE KIT", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "313", "cucop_code": "25501-0025", "specific_item_code": "25501", "cucop_description": "MECHERO", "description": "YSI 2002 GALVANIC DO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "314", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "FILTRO DE VIDRIO SINTERIZADO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "315", "cucop_code": "25501-0009", "specific_item_code": "25501", "cucop_description": "CRISOL", "description": "CRISOLES DE PORCELANA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "316", "cucop_code": "25501-0098", "specific_item_code": "25501", "cucop_description": "PAPEL FILTRO", "description": "PLIEGO DE PAPEL FILTRO", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "317", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "CHAROLA PARA HORNEAR DE ALUMINIO - 13 X 18 X 1\", MEDIA CHAROLA", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "318", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PRENSA PARA TORTILLAS, 15.24 CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "319", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "RODILLO DE MADERA DE 17.6 PULGADAS PARA HORNEAR", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "320", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "PALA MISERABLE SILICON", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "321", "cucop_code": "25501-0035", "specific_item_code": "25501", "cucop_description": "PORTA OBJETOS", "description": "BOWL, TAZÓN DE ACERO INOXIDABLE MEDIANO DE 28CM X 11.5CM", "requested_quantity": null, "minimum_quantity": null, "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": "1", "maximum_amount": "1", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] } ], "budget_items": [ { "code": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "code": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "awards": [ { "id": "C-2023-00071312", "internal_reference": "CP-VER-PD-AD-017/2023", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LAB.", "status": "PUBLICADO", "contractor": { "name": "COMERCIALIZADORA ALPHALAB S DE RL DE CV", "normalized_name": "COMERCIALIZADORA ALPHALAB", "rfc_type": null, "slug": "comercializadora-alphalab" }, "contract_period": { "published_at": "2023-07-11T18:18:57.000Z", "starts_at": "2023-07-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "704757.13", "tax": "112664.49", "total": "817421.62", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "1-METHYLBUTYL ACETATE, 100 GRAMOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2421.76", "subtotal": "2421.76", "tax": "387.48", "other_taxes": null, "total": "2809.24", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0039", "description": "ACETATO DE SODIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "162.67", "subtotal": "162.67", "tax": "26.03", "other_taxes": null, "total": "188.7", "cucop_description": "SUSTANCIAS QUÍMICAS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0040", "description": "ACETATO DE SODIO R.A, CRISTAL 2.5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1185.33", "subtotal": "1185.33", "tax": "189.65", "other_taxes": null, "total": "1374.98", "cucop_description": "SULFATO DE AMONIO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0041", "description": "ACETONA =99.5% 4 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1060.67", "subtotal": "1060.67", "tax": "169.71", "other_taxes": null, "total": "1230.38", "cucop_description": "HULE SINTETICO Y ELASTOMEROS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0042", "description": "ACETONA GARRAFA 20 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2970.67", "subtotal": "2970.67", "tax": "475.31", "other_taxes": null, "total": "3445.98", "cucop_description": "PASTA AL SULFATO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0043", "description": "ÁCIDO ACÉTICO AL 98 % PRESENTACIÓN DE 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "339.33", "subtotal": "339.33", "tax": "54.29", "other_taxes": null, "total": "393.62", "cucop_description": "PASTA DE BAGAZO VISCOSA", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0044", "description": "ÁCIDO ACÉTICO GLACIAL PRESENTACIÓN DE 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "339.33", "subtotal": "339.33", "tax": "54.29", "other_taxes": null, "total": "393.62", "cucop_description": "PASTA MECANICA", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0046", "description": "ÁCIDO ANHIDRIDO ACÉTICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "191.33", "subtotal": "191.33", "tax": "30.61", "other_taxes": null, "total": "221.94", "cucop_description": "PULIMENTOS Y LUSTRADORES", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0046", "description": "ÁCIDO CLORHIDRICO GRADO ANALITICO 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "236", "subtotal": "236", "tax": "37.76", "other_taxes": null, "total": "273.76", "cucop_description": "PULIMENTOS Y LUSTRADORES", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0047", "description": "ÁCIDO CLORHIDRICO GRADO REACTIVO DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "781.33", "subtotal": "781.33", "tax": "125.01", "other_taxes": null, "total": "906.34", "cucop_description": "SULFATO DE ALUMINIO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "ÁCIDO FOSFOWOLFRÁMICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3781.76", "subtotal": "3781.76", "tax": "605.08", "other_taxes": null, "total": "4386.84", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0053", "description": "ÁCIDO SULFÚRICO CONCENTRADO PRESENTACIÓN 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "306.67", "subtotal": "306.67", "tax": "49.07", "other_taxes": null, "total": "355.74", "cucop_description": "POLIURETANO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0054", "description": "ÁCIDO SULFURICO GRADO ANALITICO 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "306.67", "subtotal": "306.67", "tax": "49.07", "other_taxes": null, "total": "355.74", "cucop_description": "RODAMINA", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0055", "description": "ÁCIDO SULFURICO GRADO REACTIVO 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "306.67", "subtotal": "306.67", "tax": "49.07", "other_taxes": null, "total": "355.74", "cucop_description": "SAFRANINA", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0056", "description": "ÁCIDO SULFURICO GRADO REACTIVO DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1016.67", "subtotal": "1016.67", "tax": "162.67", "other_taxes": null, "total": "1179.34", "cucop_description": "SULFATO DE SODIO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0057", "description": "ÁCIDO VALÉRICO DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2206.47", "subtotal": "2206.47", "tax": "353.04", "other_taxes": null, "total": "2559.51", "cucop_description": "SULFATO DE ZINC", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0058", "description": "AGAR BACTERIOLOGICO FRASCO DE 250 GRS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1905.77", "subtotal": "1905.77", "tax": "304.92", "other_taxes": null, "total": "2210.69", "cucop_description": "SULFITO DE BISMUTO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA DESTILADA 20 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "257.69", "subtotal": "257.69", "tax": null, "other_taxes": null, "total": "257.69", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA DESTILADA BOTELLAS DE 1 LITRO CADA UNO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "68", "subtotal": "68", "tax": "10.88", "other_taxes": null, "total": "78.88", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA DESTILADA GALÓN DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "99.33", "subtotal": "99.33", "tax": "15.89", "other_taxes": null, "total": "115.22", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA DESTILADA GARRAFÓN DE 19 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "346.4", "subtotal": "346.4", "tax": null, "other_taxes": null, "total": "346.4", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL AMÍLICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "354.67", "subtotal": "354.67", "tax": "56.75", "other_taxes": null, "total": "411.42", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL ETILICO AL 96% CON 20 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "916.01", "subtotal": "916.01", "tax": "146.56", "other_taxes": null, "total": "1062.57", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL ISOAMILICO GRADO ACS DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3570", "subtotal": "3570", "tax": "571.2", "other_taxes": null, "total": "4141.2", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL ISOPROPILICO GRADO ACS DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1058.67", "subtotal": "1058.67", "tax": "169.39", "other_taxes": null, "total": "1228.06", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALCOHOL METILICO GRADO ACS DE 4 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "758", "subtotal": "758", "tax": "121.28", "other_taxes": null, "total": "879.28", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ALGINATO DE SODIO EN POLVO GRADO ALIMENTICIO PRESENTACIÓN DE 1 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "686.21", "subtotal": "686.21", "tax": "109.79", "other_taxes": null, "total": "796", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ANHIDRIDO ACÉTICO AL 99% DE PUREZA PRESENTACIÓN DE 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3833.53", "subtotal": "3833.53", "tax": "613.36", "other_taxes": null, "total": "4446.89", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BACTOZOLTM. KIT PARA AISLACIÓN DE ADN BACTERIANO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5266", "subtotal": "5266", "tax": "842.56", "other_taxes": null, "total": "6108.56", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BPW AGUA PEPTONADA TAMPONADA 500 GRS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1635.33", "subtotal": "1635.33", "tax": "261.65", "other_taxes": null, "total": "1896.98", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER PH 10 DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "75", "subtotal": "75", "tax": "12", "other_taxes": null, "total": "87", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER PH 4 DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "75", "subtotal": "75", "tax": "12", "other_taxes": null, "total": "87", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER PH 7 DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "75", "subtotal": "75", "tax": "12", "other_taxes": null, "total": "87", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CARBON ACTIVADO 100G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "96.67", "subtotal": "96.67", "tax": "15.47", "other_taxes": null, "total": "112.14", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CARBORUMDUM -CARBURO DE SILICONA CALIBRE FINO FRASCO DE 250 GR (SILICON CARBIDE -400 MESH PARTICLE SIZE, =97.5% SINÓNIMOS: CARBON SILICIDE, CARBORUNDUM, METHANIDYLIDYNESILANYLIUM, SILICON MONOCARBIDE 250 G)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1461.76", "subtotal": "1461.76", "tax": "233.88", "other_taxes": null, "total": "1695.64", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CGINT GGCCTCCCGCCTCCGGGCGG 25 NM ESTÁNDAR DESALADO 20", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "184.27", "subtotal": "184.27", "tax": "29.48", "other_taxes": null, "total": "213.75", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CGINT: GGCCTCCCGCCTCCGGGCGG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "191.33", "subtotal": "191.33", "tax": "30.61", "other_taxes": null, "total": "221.94", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLOROFORMO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "383.33", "subtotal": "383.33", "tax": "61.33", "other_taxes": null, "total": "444.66", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE CALCIO ANHÍDRO ACS DE 500 GRS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "992", "subtotal": "992", "tax": "158.72", "other_taxes": null, "total": "1150.72", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE HIERRO (III) PRESENTACIÓN DE 500 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1255.33", "subtotal": "1255.33", "tax": "200.85", "other_taxes": null, "total": "1456.18", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO MERCÚRICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "485.33", "subtotal": "485.33", "tax": "77.65", "other_taxes": null, "total": "562.98", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "DIHIDRÓGENO FOSFATO DE POTASIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2284.12", "subtotal": "2284.12", "tax": "365.46", "other_taxes": null, "total": "2649.58", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTER DEL ÁCIDO 2-AMINOETILDIFENIL BÓRICO (AEDBE) PRESENTACIÓN 5 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2544.12", "subtotal": "2544.12", "tax": "407.06", "other_taxes": null, "total": "2951.18", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ETHYL 4-[BENZYL(METHYL)AMINO]BUTANOATE PH017049-1G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4292.35", "subtotal": "4292.35", "tax": "686.78", "other_taxes": null, "total": "4979.13", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "EXTRACTO DE TÉ VERDE ESTANDARIZADO EN CAPSULAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1151.15", "subtotal": "1151.15", "tax": "184.18", "other_taxes": null, "total": "1335.33", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "FENOLFTALEÍNA 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "41.2", "subtotal": "41.2", "tax": "6.59", "other_taxes": null, "total": "47.79", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "FOSFATO DE CALCIO CA3(PO4)2 (FOSFATO TRICÁLCICO). FRASCO DE 250 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "264", "subtotal": "264", "tax": "42.24", "other_taxes": null, "total": "306.24", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "GLICEROL PURO GRADO REACTIVO PRESENTACIÓN 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "352.67", "subtotal": "352.67", "tax": "56.43", "other_taxes": null, "total": "409.1", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "HEXANO GA LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "420.67", "subtotal": "420.67", "tax": "67.31", "other_taxes": null, "total": "487.98", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "HEXYL ACETATE, 25 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1241.76", "subtotal": "1241.76", "tax": "198.68", "other_taxes": null, "total": "1440.44", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓXIDO DE SODIO GRADO ANALÍTICO FRASCO DE 500 GRAMOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "364.67", "subtotal": "364.67", "tax": "58.35", "other_taxes": null, "total": "423.02", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDROXIDO DE SODIO GRADO REACTIVO 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "132", "subtotal": "132", "tax": "21.12", "other_taxes": null, "total": "153.12", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ISODINE FRASCO (500 ML)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "203.13", "subtotal": "203.13", "tax": "32.5", "other_taxes": null, "total": "235.63", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ITS 1: TCCGTAGGTGAACCTGCGG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "184.27", "subtotal": "184.27", "tax": "29.48", "other_taxes": null, "total": "213.75", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ITS 4: TCCTCCGCTTATTGATATGC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "191.33", "subtotal": "191.33", "tax": "30.61", "other_taxes": null, "total": "221.94", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ITS1 TCCGTAGGTGAACCTGCGG 25 NM ESTÁNDAR DESALADO 19", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "184.27", "subtotal": "184.27", "tax": "29.48", "other_taxes": null, "total": "213.75", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ITS4 TCCTCCGCTTATTGATATGC 25 NM ESTÁNDAR DESALADO 20", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "191.33", "subtotal": "191.33", "tax": "30.61", "other_taxes": null, "total": "221.94", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT DE LIMPIEZA DE GEL Y PCR QIAQUICK (100). PARA PURIFICACIÓN DE FRAGMENTOS DE PCR Y EXTRACCIONES EN GEL DE 100 REACCIONES (AL MENOS 80-100 REACCIONES EN GEL O 100 PCR).", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8411.25", "subtotal": "8411.25", "tax": "1345.8", "other_taxes": null, "total": "9757.05", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO BASAL DE MURASHIGE Y SKOOG 50 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2610.9", "subtotal": "2610.9", "tax": "417.74", "other_taxes": null, "total": "3028.64", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO B-KING PARA CULTIVO DE BACTERIAS 500 GRS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "METANOL AL 99% DE PUREZA PRESENTACIÓN 20 LITROS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1885", "subtotal": "1885", "tax": "301.6", "other_taxes": null, "total": "2186.6", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "MOLIBDATO DE SODIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "373.33", "subtotal": "373.33", "tax": "59.73", "other_taxes": null, "total": "433.06", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "N-BUTANOL PRESENTACIÓN DE 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1594.71", "subtotal": "1594.71", "tax": "255.15", "other_taxes": null, "total": "1849.86", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NINHIDRINA PRESENTACIÓN DE 10 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "391.33", "subtotal": "391.33", "tax": "62.61", "other_taxes": null, "total": "453.94", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO BÁSICO DE BISMUTO (III) PRESENTACIÓN DE 100 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "694", "subtotal": "694", "tax": "111.04", "other_taxes": null, "total": "805.04", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE AMONIO GRADO REACTIVO ANALÍTICO DE 2.5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2420", "subtotal": "2420", "tax": "387.2", "other_taxes": null, "total": "2807.2", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE BISMUTO PENTAHIDRATADO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "694", "subtotal": "694", "tax": "111.04", "other_taxes": null, "total": "805.04", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE POTASIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "165.67", "subtotal": "165.67", "tax": "26.51", "other_taxes": null, "total": "192.18", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE POTASIO (KNO3). FRASCO DE 100 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "158.87", "subtotal": "158.87", "tax": "25.42", "other_taxes": null, "total": "184.29", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE POTASIO GRADO REACTIVO ANALÍTICO DE 2.5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2264", "subtotal": "2264", "tax": "362.24", "other_taxes": null, "total": "2626.24", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE POTASIO PRESENTACIÓN EN FRASCO DE 1 KG EN POLVO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "174.67", "subtotal": "174.67", "tax": "27.95", "other_taxes": null, "total": "202.62", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEROXIDO DE HIDROGENO 30% GRADO REACTIVO 4 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1107.33", "subtotal": "1107.33", "tax": "177.17", "other_taxes": null, "total": "1284.5", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "PÉROXIDO DE HIDRÓGENO AL 30% RA, PRESENTACIÓN DE 1 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "279.33", "subtotal": "279.33", "tax": "44.69", "other_taxes": null, "total": "324.02", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "PHYTAGEL FRASCO (250G)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3301.76", "subtotal": "3301.76", "tax": "528.28", "other_taxes": null, "total": "3830.04", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "POLY(VINYLPOLYPYRROLIDONE) 100 GRS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2887.65", "subtotal": "2887.65", "tax": "462.02", "other_taxes": null, "total": "3349.67", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "PÚRPURA DE BROMOCRESOL FRASCO DE 250 G PARA USO MICROBIOLÓGICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6057.06", "subtotal": "6057.06", "tax": "969.13", "other_taxes": null, "total": "7026.19", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "QUICK-RNA MICROPREP ZYMO RESEARCH KIT DE 200 MUESTRAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "24250", "subtotal": "24250", "tax": "3880", "other_taxes": null, "total": "28130", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA FOSFORO RANGO MEDIO HI93706A-0 CAJA CON 100 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "706", "subtotal": "706", "tax": "112.96", "other_taxes": null, "total": "818.96", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA FOSFORO RANGO MEDIO HI93706B-0 CAJA CON 100 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "706", "subtotal": "706", "tax": "112.96", "other_taxes": null, "total": "818.96", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVOS PARA FÓSFORO , PAQUETE CON 100 REACTIVOS HI93706A-0", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "706", "subtotal": "706", "tax": "112.96", "other_taxes": null, "total": "818.96", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVOS PARA FÓSFORO , PAQUETE CON 100 REACTIVOS HI93706B-0", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "706", "subtotal": "706", "tax": "112.96", "other_taxes": null, "total": "818.96", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "RVS 12.75G RAPPAPORT-VASSILIADIS-SOYA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "65284.66", "subtotal": "65284.66", "tax": "10445.55", "other_taxes": null, "total": "75730.21", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SACAROSA FRASCO DE 450G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "655.55", "subtotal": "655.55", "tax": "104.89", "other_taxes": null, "total": "760.44", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SILICON STANDARD PARA AAS TRACECERT 1000 MG/L SI IN NAOH", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1351.18", "subtotal": "1351.18", "tax": "216.19", "other_taxes": null, "total": "1567.37", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SODIO HEXAMETAFOSFATO 65-70% DE 5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7253.53", "subtotal": "7253.53", "tax": "1160.56", "other_taxes": null, "total": "8414.09", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SODIUM CARBONATE, ANHYDROUS, POWDER, FRASCO 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "579.33", "subtotal": "579.33", "tax": "92.69", "other_taxes": null, "total": "672.02", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SODIUM CARBONATE, ANHYDROUS, POWDER, FRASCO 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "579.33", "subtotal": "579.33", "tax": "92.69", "other_taxes": null, "total": "672.02", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCION DE BUFFER PH CONTROL PH 10 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "57.67", "subtotal": "57.67", "tax": "9.23", "other_taxes": null, "total": "66.9", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCION DE BUFFER PH CONTROL PH 4. 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "57.67", "subtotal": "57.67", "tax": "9.23", "other_taxes": null, "total": "66.9", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCION DE BUFFER PH CONTROL PH 7 500 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "57.67", "subtotal": "57.67", "tax": "9.23", "other_taxes": null, "total": "66.9", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO CÚPRICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "314", "subtotal": "314", "tax": "50.24", "other_taxes": null, "total": "364.24", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE CALCIO (CASO4). FCO DE 250 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "400.67", "subtotal": "400.67", "tax": "64.11", "other_taxes": null, "total": "464.78", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE COBRE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "314", "subtotal": "314", "tax": "50.24", "other_taxes": null, "total": "364.24", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE MAGNESIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "162", "subtotal": "162", "tax": "25.92", "other_taxes": null, "total": "187.92", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE MANGANESO ANHIDRO MNSO4 FCO DE 100 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "162", "subtotal": "162", "tax": "25.92", "other_taxes": null, "total": "187.92", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE POTASIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "210.67", "subtotal": "210.67", "tax": "33.71", "other_taxes": null, "total": "244.38", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SULFATO DE ZINC", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "176", "subtotal": "176", "tax": "28.16", "other_taxes": null, "total": "204.16", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "TARTRATO DE SODIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "352", "subtotal": "352", "tax": "56.32", "other_taxes": null, "total": "408.32", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRICLORURO FÉRRICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "310", "subtotal": "310", "tax": "49.6", "other_taxes": null, "total": "359.6", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 20 (POLISORBATO 20) DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "452", "subtotal": "452", "tax": "72.32", "other_taxes": null, "total": "524.32", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "TWEEN 20 (POLISORBATO 20) DE 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "452", "subtotal": "452", "tax": "72.32", "other_taxes": null, "total": "524.32", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "WP200I GAMMA IRRAD COLILERT 100ML 200PK(AMPOLLETAS PARA DETECCIÓN DE COLIFORMES Y E. COLI) PARA 100 ML. AYAG981297300. 12352200.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "31679.73", "subtotal": "31679.73", "tax": "5068.76", "other_taxes": null, "total": "36748.49", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "WPSE020I GAMMA IR PSEUDALERT 100ML 20PK. AYAG981807600. 12352200", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4335.86", "subtotal": "4335.86", "tax": "693.74", "other_taxes": null, "total": "5029.6", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "YODURO DE POTASIO PRESENTACIÓN DE 100 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "627.33", "subtotal": "627.33", "tax": "100.37", "other_taxes": null, "total": "727.7", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ZYMOBIOMICS DNA MICROPREP KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2187.5", "subtotal": "2187.5", "tax": "350", "other_taxes": null, "total": "2537.5", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ZYMOBIOMICS DNA MINIPREP KIT (LYSIS TUBES) 50 PREPS. D4300", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11125", "subtotal": "11125", "tax": "1780", "other_taxes": null, "total": "12905", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO CLORHÍDTICO VALORADO 0.1 N PRESENTACIÓN 2 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "92.86", "subtotal": "92.86", "tax": "14.86", "other_taxes": null, "total": "107.72", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓXIDO DE SODFIO LENTEJAS J.T. BAKER PRESENTACIÓN 5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1582.14", "subtotal": "1582.14", "tax": "253.14", "other_taxes": null, "total": "1835.28", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACETONITRILO PRESENTACIÓN 2 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "550", "subtotal": "550", "tax": "88", "other_taxes": null, "total": "638", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "METANOL PRESENTACIÓN 2 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "585.71", "subtotal": "585.71", "tax": "93.71", "other_taxes": null, "total": "679.42", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CITRATO DE TRISÓDICO DIHIDRATO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "296.43", "subtotal": "296.43", "tax": "47.43", "other_taxes": null, "total": "343.86", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "L-AMINOÁCIDOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7913.33", "subtotal": "7913.33", "tax": "1266.13", "other_taxes": null, "total": "9179.46", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTÁNDAR DE AMINOÁCIDO PRESENTACIÓN 5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2782.67", "subtotal": "2782.67", "tax": "445.23", "other_taxes": null, "total": "3227.9", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NORLEUCINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2464", "subtotal": "2464", "tax": "394.24", "other_taxes": null, "total": "2858.24", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NORVALINA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2724", "subtotal": "2724", "tax": "435.84", "other_taxes": null, "total": "3159.84", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ÁCIDO SULFÚRICO CONCENTRADO PRESENTACIÓN 4L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1162.86", "subtotal": "1162.86", "tax": "186.06", "other_taxes": null, "total": "1348.92", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "HEXANO GRADO REACTIVO PRESENTACIÓN 20 L", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3017.86", "subtotal": "3017.86", "tax": "482.86", "other_taxes": null, "total": "3500.72", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOL. ESTANDAR DE FOSOFORO 100 ML. 170340-0100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3101.33", "subtotal": "3101.33", "tax": "496.21", "other_taxes": null, "total": "3597.54", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESTANDAR DE CALCIO 100 ML. 119778-0100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "969.33", "subtotal": "969.33", "tax": "155.09", "other_taxes": null, "total": "1124.42", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACIDO GIBERELICO -BIOGIB 10GR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "315.54", "subtotal": "315.54", "tax": "50.49", "other_taxes": null, "total": "366.03", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ACIDO FOSFORICO RA. 2.5 LTS. 0260-05", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2376.34", "subtotal": "2376.34", "tax": "380.21", "other_taxes": null, "total": "2756.55", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0002", "description": "APARATO DE FILTRACION CAP. ENBUDO 300 ML. CAP MATRAZ 1000 ML. MEMBRANA 47 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8076.87", "subtotal": "8076.87", "tax": "1292.3", "other_taxes": null, "total": "9369.17", "cucop_description": "APARATO PARA DEMOSTRAR LA CONSERVACION DE LA ENERGIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0002", "description": "APARATO DE FILTRACION CAP. ENBUDO 300 ML. CAP MATRAZ 500 ML. MEMBRANA 47 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11973.69", "subtotal": "11973.69", "tax": "1915.79", "other_taxes": null, "total": "13889.48", "cucop_description": "APARATO PARA DEMOSTRAR LA CONSERVACION DE LA ENERGIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0065", "description": "BANDEJAS PARA CUANTIFICACIÓN DE BACTERIAS UTILIZANDO LOS KITS RÁPIDOS DE IDEXX CON 97 POCILLOS PAQUETE DE 100 PIEZAS NO. DE PARTE 98-21675-00 (100-PACK STERILE 97-WELL QUANTI TRAY/200(PAQUETE DE 100 CHAROLAS QUANTI-TRAY/200 CADA UNA DE 97 POZOS) AYAG982167500 ( 41122800))", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7083.03", "subtotal": "7083.03", "tax": "1133.28", "other_taxes": null, "total": "8216.31", "cucop_description": "BANDEJA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 15.9X8 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "82.74", "subtotal": "82.74", "tax": "13.24", "other_taxes": null, "total": "95.98", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 22.2X8 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "95.08", "subtotal": "95.08", "tax": "15.21", "other_taxes": null, "total": "110.29", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 38.1X8 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "100.78", "subtotal": "100.78", "tax": "16.12", "other_taxes": null, "total": "116.9", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA OCTAGONAL CON ANILLO RECUBIERTA DE TEFLON 50.8X 8MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "149.33", "subtotal": "149.33", "tax": "23.89", "other_taxes": null, "total": "173.22", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA MICRO SIN ANILLO RECUBIERTA DE TEFLON 10X3 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "82.56", "subtotal": "82.56", "tax": "13.21", "other_taxes": null, "total": "95.77", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0102", "description": "BIORREACTORES BIT CON ESPONJA DE 1 LT QUE CONTIENE CADA UNO LO SIGUIENTE: 2 FRASCO DE VIDRIO 1.0 LT. 2 TAPA DE PLASTICO ESTERILIZABLE C/2 PERFORACIONES 2 EMPAQUE PLANO DE SILICON DE 70X7X1MM LUZ. 55 MM 4 CONECTOR PASAMURO ESTERILIZABLE DE PLASTICO 8 MM. 8 EMPAQUE PLANO D/SILICON DE 16X5X2MM LUZ 8 MM 2 FILTRO HIDROFOBICO ESTERILIZABLE 50 MM D/DIAMY 0.2 UM 2 ABRAZADERA DE MUELLE PARA MANGUERA 8.9 - 9.3 MM 4 ABRAZADERA DE ALAMBRE PARA MANGUERA 9.4 -10.4 MM 0.7 MANGUERA ESTERILIZABLE DE SILICÓN PLATINIZADA 6 MM. DIAM. INT. 1 TUBO DE ACERO INOX DE 8 MM D/DIAM. DE 13 CM. C/ARANDELA 1", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3518.65", "subtotal": "3518.65", "tax": "562.98", "other_taxes": null, "total": "4081.63", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0102", "description": "BLOQUE PARA BAÑO SECO ANALOGO PARA 20 TUBOS DE 13MM , 2.0 ML ( 9 CM X 7.5 CM X 4 CM ALTO. APROX.)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4098.72", "subtotal": "4098.72", "tax": "655.8", "other_taxes": null, "total": "4754.52", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0132", "description": "BOTELLAS PLÁSTICAS CON MARCA DE LÍNEA A UN VOLUMEN DE 100 ML PAQUETE CON 200 PIEZAS (200-PACK 120ML VESSEL WITH 100ML) AYAG980615900 (41115822)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5445.32", "subtotal": "5445.32", "tax": "871.25", "other_taxes": null, "total": "6316.57", "cucop_description": "TUBO SALOMÓNICO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0130", "description": "BULBO DE HULE 2 ML DE CAPACIDAD 50 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "140", "subtotal": "140", "tax": "22.4", "other_taxes": null, "total": "162.4", "cucop_description": "BULBO DE LATEX", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0122", "description": "BURETA 100 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "652.4", "subtotal": "652.4", "tax": "104.38", "other_taxes": null, "total": "756.78", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0122", "description": "BURETA 250 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3924.62", "subtotal": "3924.62", "tax": "627.94", "other_taxes": null, "total": "4552.56", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJA DE PETRI VIDRIO, 6 CM DIAMETRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "36.4", "subtotal": "36.4", "tax": "5.82", "other_taxes": null, "total": "42.22", "cucop_description": "CAJA PETRI", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0101", "description": "CAJA PARA 100 PORTAOBJETOS COLOR NEGRA CON CORCHO- MEDIDAS 208X175X34 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "201.68", "subtotal": "201.68", "tax": "32.27", "other_taxes": null, "total": "233.95", "cucop_description": "CAJAS PLASTIFICADAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJA PETRI DE PLASTICO ESTERIL 90 X 15 MM DESECHABLES INDIVIDUALES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "33.13", "subtotal": "33.13", "tax": "5.3", "other_taxes": null, "total": "38.43", "cucop_description": "CAJA PETRI", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJAS DE PETRI DE POLIESTIRENO DESECHABLES DE 90 X 15 MM, CON 4 DIVISIONES. ESTÉRILES. CAJA DE 540 PZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1639.2", "subtotal": "1639.2", "tax": "262.27", "other_taxes": null, "total": "1901.47", "cucop_description": "CAJA PETRI", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJAS DE PETRI DE POLIESTIRENODESECHABLES DE 90 X 15 MM. SIN DIVISION. ESTÉRILES. CAJA DE 540 PZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1639.2", "subtotal": "1639.2", "tax": "262.27", "other_taxes": null, "total": "1901.47", "cucop_description": "CAJA PETRI", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0005", "description": "CAJAS DE PETRI PLÁSTICAS ESTÉRILES 90 X 15 CM.PAQUETE DE 500 PZAS. PARA CRECIMIENTO MICROBIANO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1526.67", "subtotal": "1526.67", "tax": "244.27", "other_taxes": null, "total": "1770.94", "cucop_description": "CAJA PETRI", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0102", "description": "COLILERT/COLILERT-18 COMPARATOR. PREDISPE. AYAG980922700.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "595.93", "subtotal": "595.93", "tax": "95.35", "other_taxes": null, "total": "691.28", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0107", "description": "CONÓMETRO CON 4 CANALES Y ALARMA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1288.42", "subtotal": "1288.42", "tax": "206.15", "other_taxes": null, "total": "1494.57", "cucop_description": "CRONOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0009", "description": "CRISOL DE PORCELANA FORMA ALTA CON TAPA 100 ML COORSTEK", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "282.86", "subtotal": "282.86", "tax": "45.26", "other_taxes": null, "total": "328.12", "cucop_description": "CRISOL", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0011", "description": "CUBETA DE CUARZO UV-VIS 10 MM, 3.5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2398.21", "subtotal": "2398.21", "tax": "383.71", "other_taxes": null, "total": "2781.92", "cucop_description": "CUBETA DESECHO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0011", "description": "CUBETA DE CUARZO UV-VIS 5 MM 1.7 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3290.59", "subtotal": "3290.59", "tax": "526.49", "other_taxes": null, "total": "3817.08", "cucop_description": "CUBETA DESECHO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0011", "description": "CUBETAS DE VIDRIO PARA H1832XX SERIE. CAJA CON 4 PZA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "596", "subtotal": "596", "tax": "95.36", "other_taxes": null, "total": "691.36", "cucop_description": "CUBETA DESECHO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0102", "description": "DATA LOGGER (REGISTRADOR DE DATOS) DE TEMPERATURA/HUMEDAD RELATIVA U23-001", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4629", "subtotal": "4629", "tax": "740.64", "other_taxes": null, "total": "5369.64", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "ELECTRODO PH HI1110", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4244", "subtotal": "4244", "tax": "679.04", "other_taxes": null, "total": "4923.04", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "ELECTRODO PH HI1131", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3980", "subtotal": "3980", "tax": "636.8", "other_taxes": null, "total": "4616.8", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0016", "description": "EMBUDO DE VIDRIO TALLO CORTO ANGULO 58*", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "238.4", "subtotal": "238.4", "tax": "38.14", "other_taxes": null, "total": "276.54", "cucop_description": "EMBUDO SEPARADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0102", "description": "EQUIPO DE ULTRASONIDO PORTATIL. PUEDE SER MINDRAY DP10H CON 1 TRANSDUCTOR LINEAL.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "70831.9", "subtotal": "70831.9", "tax": "11333.1", "other_taxes": null, "total": "82165", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0102", "description": "ESPATULA TIPO HEYMAN UN EXTREMO PLANO Y OTRO ACANALADO LONGITUD 150 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "106.44", "subtotal": "106.44", "tax": "17.03", "other_taxes": null, "total": "123.47", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "FRASCO PARA DILUCIÓN DE LECHE BOCA ANCHA DE VIDRIO DE BOROSILICATO, CON AFORO A 99 ML, INCLUYA TAPA FENÓLICA ROSCADA Y SELLO DE HULE ESTERILIZABLE EN AUTOCLAVE. CAPACIDAD DE 160 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "179.11", "subtotal": "179.11", "tax": "28.66", "other_taxes": null, "total": "207.77", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "FRASCOS SELLADOS HERMÉTICAMENTE CON ARILLO DE GOMA DE 800 ML-1000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "144.01", "subtotal": "144.01", "tax": "23.04", "other_taxes": null, "total": "167.05", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0102", "description": "FUENTE DE PODER PARA CAMARA DE ELECTROFORESIS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "31724", "subtotal": "31724", "tax": "5075.84", "other_taxes": null, "total": "36799.84", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA ENFRIADORA PARA 32 TUBOS TRUE NORTH MINI-COOLER, 32 POCILLOS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5148.21", "subtotal": "5148.21", "tax": "823.71", "other_taxes": null, "total": "5971.92", "cucop_description": "REJILLA PORCELANICO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA ENFRIADORA PARA 96 TUBOS DE 0.2 ML 120729 PCR COOLER, 96 POCILLOS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1999.4", "subtotal": "1999.4", "tax": "319.9", "other_taxes": null, "total": "2319.3", "cucop_description": "REJILLA PORCELANICO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA PARA CONGELACIÓN . PARA LA PROTECCIÓON DE ENZIMAS, CÉLULAS, REACTIVOS Y SOLUCIONES QUE DEBEN MANTENERSE A BAJA TEMPERATURA (-20 C) MIENTRAS SE UTILIZAN EN LABORATOIRO. CAPACIDAD DE 18 VIALES DE 0.2 A 2.0 ML. DE POLICARBONATO CON TAPA DE ROSCA DE POLIETILENO. MEDIDAS APROXIMADAS DE 117 DE DIÁMETRO X 86 MM DE ALTURA, O BIEN DE 243 MM LARGO X 157 MM DE ANCHO X 146 MM DE ALTO. CIRCULAR O RECTANGULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6652.91", "subtotal": "6652.91", "tax": "1064.47", "other_taxes": null, "total": "7717.38", "cucop_description": "REJILLA PORCELANICO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA PARA TUBOS 4 WAY RACK X PIEZA. PARA TUBOS DE 50, 15, 1.5/2.0 Y 0.5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "859.65", "subtotal": "859.65", "tax": "137.54", "other_taxes": null, "total": "997.19", "cucop_description": "REJILLA PORCELANICO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA PARA TUBOS CONICOS TUBOS DE 50 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "130.67", "subtotal": "130.67", "tax": "20.91", "other_taxes": null, "total": "151.58", "cucop_description": "REJILLA PORCELANICO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA PARA TUBOS ROTABLE. CUENTE CON 4 MÓDULOS GIRATORIOS INTERCONECTADOS CON CAPACIDAD PARA DIFERENTES TUBOS CÓNICOS DE 15- 50 ML Y 1.5 ML. ESTERIZABLE EN AUTOCLAVE. CADA MÓDULO DE DIFEREENTE COLOR: VIOLETA, AMARILLO, AZUL Y VERDE.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "918.66", "subtotal": "918.66", "tax": "146.99", "other_taxes": null, "total": "1065.65", "cucop_description": "REJILLA PORCELANICO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0126", "description": "GRADILLA ROTATORIA CAPACIDAD 10 A 17 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "918.66", "subtotal": "918.66", "tax": "146.99", "other_taxes": null, "total": "1065.65", "cucop_description": "REJILLA PORCELANICO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "JUEGO DE MICROPIPETAS FINNPIPETTE FINNP70700 CON 4 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "27766.25", "subtotal": "27766.25", "tax": "4442.6", "other_taxes": null, "total": "32208.85", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0102", "description": "KIT SINGLE PATH SAMONELLA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5374.71", "subtotal": "5374.71", "tax": "859.95", "other_taxes": null, "total": "6234.66", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0079", "description": "MASCARA PARA GASES (GRANDE)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "474.36", "subtotal": "474.36", "tax": "75.9", "other_taxes": null, "total": "550.26", "cucop_description": "PAÑUELOS ANTIESTATICOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "171.67", "subtotal": "171.67", "tax": "27.47", "other_taxes": null, "total": "199.14", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 1000ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "555.03", "subtotal": "555.03", "tax": "88.8", "other_taxes": null, "total": "643.83", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 100ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "282.35", "subtotal": "282.35", "tax": "45.18", "other_taxes": null, "total": "327.53", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 2000ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1354.63", "subtotal": "1354.63", "tax": "216.74", "other_taxes": null, "total": "1571.37", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ ESMERILADO SOXHLET 250 ML, 24/40", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "492.25", "subtotal": "492.25", "tax": "78.76", "other_taxes": null, "total": "571.01", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "MEDIDOR DE CALIDAD DE AGUA PH", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "804.6", "subtotal": "804.6", "tax": "128.74", "other_taxes": null, "total": "933.34", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "MEDIDOR DE PH, TEMPERATURA, ACIDEZ Y ALCALINIDAD PARA SUELO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "469.08", "subtotal": "469.08", "tax": "75.05", "other_taxes": null, "total": "544.13", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "MICROTUBOS COLOR AMBAR DE POLIPROPILENO PARA MICROCENTRÍFUGA DE 1.5 ML. LIBRES DE DNASAS, RNASAS E INHIBIDORES DE PCR. BOLSA DE 500 A 1000 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4426.23", "subtotal": "4426.23", "tax": "708.2", "other_taxes": null, "total": "5134.43", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "MICROTUBOS TRANSPARENTE DE POLIPROPILENO PARA MICROCENTRÍFUGA DE 1.5 ML. LIBRES DE DNASAS, RNASAS E INHIBIDORES DE PCR. BOLSA DE 1,000 PZAS. PARA EXTRACCIÓN DE ADN. BIOLOGÍA MOLECULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "662.35", "subtotal": "662.35", "tax": "105.98", "other_taxes": null, "total": "768.33", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 0.1-2.5 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1399.2", "subtotal": "1399.2", "tax": "223.87", "other_taxes": null, "total": "1623.07", "cucop_description": "MICROPIPETAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 100-1000 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1399.2", "subtotal": "1399.2", "tax": "223.87", "other_taxes": null, "total": "1623.07", "cucop_description": "MICROPIPETAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 20-200 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1399.2", "subtotal": "1399.2", "tax": "223.87", "other_taxes": null, "total": "1623.07", "cucop_description": "MICROPIPETAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 5-10 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1399.2", "subtotal": "1399.2", "tax": "223.87", "other_taxes": null, "total": "1623.07", "cucop_description": "MICROPIPETAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 10-100 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1399.2", "subtotal": "1399.2", "tax": "223.87", "other_taxes": null, "total": "1623.07", "cucop_description": "MICROPIPETAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0027", "description": "MORTERO DE PORCELANA CON PISTILO DE 125 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "145.71", "subtotal": "145.71", "tax": "23.31", "other_taxes": null, "total": "169.02", "cucop_description": "MORTERO DE LABORATORIO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0094", "description": "OWL A3-1 LARGE-GEL ELECTROPHORESISSYSTEMWELL-SUITED FOR PLANT GENOMICS STUDIES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "38465", "subtotal": "38465", "tax": "6154.4", "other_taxes": null, "total": "44619.4", "cucop_description": "SENSOR OPTICO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0098", "description": "PALL FILTROS ESTÉRILES ACRODISC™ PARA JERINGAS CON MEMBRANA SUPOR™ CON MEMBRANAS DE POLIESTERSULFONA (PES). PALL. CAT. 4611 (0,1 µM 25 MM). CAJA DE 50 PZAS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8774.36", "subtotal": "8774.36", "tax": "1403.9", "other_taxes": null, "total": "10178.26", "cucop_description": "PAPEL FILTRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO NO. 42 WHATMAN,DIÁMETRO 110MM, PAQUETE CON 100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1349.55", "subtotal": "1349.55", "tax": "215.93", "other_taxes": null, "total": "1565.48", "cucop_description": "PAPEL FILTRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL FILTRO WHATMAN NO. 1, DIAMETRO 110 MM CAJA CON 100", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "436.55", "subtotal": "436.55", "tax": "69.85", "other_taxes": null, "total": "506.4", "cucop_description": "PAPEL FILTRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0098", "description": "PAPEL PARAFILM 100 MM X 75 M \"M\"SEALING", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1284.41", "subtotal": "1284.41", "tax": "205.51", "other_taxes": null, "total": "1489.92", "cucop_description": "PAPEL FILTRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS 2 DEDOS CON NUEZ GIRATORIA, 12-45 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "149", "subtotal": "149", "tax": "23.84", "other_taxes": null, "total": "172.84", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS PARA PAPEL DE ACERO INOXIDABLE CON PUNTA CURVA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "307.12", "subtotal": "307.12", "tax": "49.14", "other_taxes": null, "total": "356.26", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS PARA VASO CUBIERTA DE VINILO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "98", "subtotal": "98", "tax": "15.68", "other_taxes": null, "total": "113.68", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS SENCILLA PARA BURETARECUBIERTA DE VINILO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "149", "subtotal": "149", "tax": "23.84", "other_taxes": null, "total": "172.84", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS TIPO RELOJERO LARGAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "274.71", "subtotal": "274.71", "tax": "43.95", "other_taxes": null, "total": "318.66", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETA DE VIDRIO DE 1100 MILILITROS PARA DETERMINAR TEXTURA DEL SUELO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1795.35", "subtotal": "1795.35", "tax": "287.26", "other_taxes": null, "total": "2082.61", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETAS GRADUADAS DE VIDRIO DE 500 MILILITROS (ML)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "586.29", "subtotal": "586.29", "tax": "93.81", "other_taxes": null, "total": "680.1", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS AMARILLAS DE 20 A 200 µL,PAQUETE CON 1000 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "228.67", "subtotal": "228.67", "tax": "36.59", "other_taxes": null, "total": "265.26", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS PARA MICROPIPETA AMARILLAS (20 A 200 UL) EN RACK ESTÉRILES DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS LA CAJA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1026.67", "subtotal": "1026.67", "tax": "164.27", "other_taxes": null, "total": "1190.94", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS PARA MICROPIPETA AZULES (1000 UL) EN CAJAS ESTÉRILES (RACK DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS TOTALES.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1820", "subtotal": "1820", "tax": "291.2", "other_taxes": null, "total": "2111.2", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "PUNTAS PARA MICROPIPETA BLACAS (0.5-10 UL) EN CAJAS ESTÉRILES (RACK DE 96 PUNTAS) LIBRES DE RNASAS Y DNASAS. CAJA CON 10 RACKS. 960 PUNTAS EN TOTAL.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "980", "subtotal": "980", "tax": "156.8", "other_taxes": null, "total": "1136.8", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0043", "description": "SOPORTE UNIVERSAL CON VARILLA DE 60 CM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "195", "subtotal": "195", "tax": "31.2", "other_taxes": null, "total": "226.2", "cucop_description": "SOPORTE PARA LABORATORIO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0057", "description": "TAPA P/ TUBO DE ENSAYE DEL Nº 9820", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4.06", "subtotal": "4.06", "tax": "0.65", "other_taxes": null, "total": "4.71", "cucop_description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOHIGRÓMETRO DIGITAL PARA INTERIOR Y EXTERIOR CON REGISTRO DE TEMPERATURA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "457.82", "subtotal": "457.82", "tax": "73.25", "other_taxes": null, "total": "531.07", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOHIGRÓMETRO PARA INTERIOR Y EXTERIOR. PARA REGISTRO DE TEMPERATURA Y HUMEDAD. REGISTRE MÁXIMOS Y MÍNIMOS DE DICHAS VARIABLES.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "457.82", "subtotal": "457.82", "tax": "73.25", "other_taxes": null, "total": "531.07", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOMETRO DE VIDRIO DE -10 A 260", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "184.75", "subtotal": "184.75", "tax": "29.56", "other_taxes": null, "total": "214.31", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOMETRO DE VIDRIO DE -20 A 250", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "184.75", "subtotal": "184.75", "tax": "29.56", "other_taxes": null, "total": "214.31", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOMETRO DE VIDRIO DE -50 A 50", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "212", "subtotal": "212", "tax": "33.92", "other_taxes": null, "total": "245.92", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMÓMETRO INFRARRORO TIPO PISTOLA CON LASER", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "627.23", "subtotal": "627.23", "tax": "100.36", "other_taxes": null, "total": "727.59", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMÓMETRO MÁXIMO MÍNIMO PARA INVERNADERO O JARDÍN, TEMPERATURAS MÁXIMAS Y MÍNIMAS, ACCESORIOS DE INVERNADERO PARA INTERIORES Y EXTERIORES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1020.42", "subtotal": "1020.42", "tax": "163.27", "other_taxes": null, "total": "1183.69", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0057", "description": "TROMPA DE VACIO 6140-0010", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "446.15", "subtotal": "446.15", "tax": "71.38", "other_taxes": null, "total": "517.53", "cucop_description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBO DE ENSAYE Nº 9820", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8.53", "subtotal": "8.53", "tax": "1.36", "other_taxes": null, "total": "9.89", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBO PARA DIGESTION LABCONCO 250ML, COD. 23030 Ó 23040. CAJA CON 25", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "49683.75", "subtotal": "49683.75", "tax": "7949.4", "other_taxes": null, "total": "57633.15", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS DE ENSAYE DE VIDRIO DE BOROSILICATO (10X75 MM) PARA CULTIVO MICROBIOLÓGICO. AUTOCLAVABLES. SIN LABIO. QUÍMICA. CON ÁREA PARA MARCAR EN ESMALTE DE CERÁMICA BLANCA.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11.08", "subtotal": "11.08", "tax": "1.77", "other_taxes": null, "total": "12.85", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS DE FONDO PLANO DE 20 X 120 MM. DE FABRICACIÓN NACIONAL. 10 PZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7", "subtotal": "7", "tax": "1.12", "other_taxes": null, "total": "8.12", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS DE POLIPROPILENO CÓNICOS PLÁSTICOS DE 15 ML, GRADUADOS. TIPO FALCON. BOLSA DE 500 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "233.33", "subtotal": "233.33", "tax": "37.33", "other_taxes": null, "total": "270.66", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS DE POLIPROPILENO CÓNICOS PLÁSTICOS DE 50 ML DE FONDO PLANO, GRADUADOS. TIPO FALCON. BOLSA DE 50 PZAS. PARA USO EN BIOLOGÍA MOLECULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "317.33", "subtotal": "317.33", "tax": "50.77", "other_taxes": null, "total": "368.1", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS EPPENDORF DE 1.5 ML, PAQUETE CON 1000 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "690.67", "subtotal": "690.67", "tax": "110.51", "other_taxes": null, "total": "801.18", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "TUBOS EPPENDORF DE 2 ML, PAQUETE CON 1000 PIEZAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "858.67", "subtotal": "858.67", "tax": "137.39", "other_taxes": null, "total": "996.06", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 1000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "135.72", "subtotal": "135.72", "tax": "21.72", "other_taxes": null, "total": "157.44", "cucop_description": "VASOS COMUNICANTES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0133", "description": "VIALES AMBAR DE 5 ML CON TAPA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "936.95", "subtotal": "936.95", "tax": "149.91", "other_taxes": null, "total": "1086.86", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0133", "description": "VIALES AMBAR DE 50 ML CON TAPA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "995.15", "subtotal": "995.15", "tax": "159.22", "other_taxes": null, "total": "1154.37", "cucop_description": "VIAL / VIALES CON ACCESORIOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0025", "description": "Y&M-CI(YEAST & MOLD COLOR INDICATOR)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7126.18", "subtotal": "7126.18", "tax": "1140.19", "other_taxes": null, "total": "8266.37", "cucop_description": "MECHERO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0025", "description": "YSI 1001 PH PROBE KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5562.82", "subtotal": "5562.82", "tax": "890.05", "other_taxes": null, "total": "6452.87", "cucop_description": "MECHERO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0025", "description": "YSI 1004 AMMONIUM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "11783.33", "subtotal": "11783.33", "tax": "1885.33", "other_taxes": null, "total": "13668.66", "cucop_description": "MECHERO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0025", "description": "YSI 1005 CHLORIDE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12074.94", "subtotal": "12074.94", "tax": "1931.99", "other_taxes": null, "total": "14006.93", "cucop_description": "MECHERO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0025", "description": "YSI 1006 NITRITE PROBE KIT", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "12074.94", "subtotal": "12074.94", "tax": "1931.99", "other_taxes": null, "total": "14006.93", "cucop_description": "MECHERO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0025", "description": "YSI 2002 GALVANIC DO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6112.47", "subtotal": "6112.47", "tax": "978", "other_taxes": null, "total": "7090.47", "cucop_description": "MECHERO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "FILTRO DE VIDRIO SINTERIZADO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3327.77", "subtotal": "3327.77", "tax": "532.44", "other_taxes": null, "total": "3860.21", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0009", "description": "CRISOLES DE PORCELANA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "47.14", "subtotal": "47.14", "tax": "7.54", "other_taxes": null, "total": "54.68", "cucop_description": "CRISOL", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0098", "description": "PLIEGO DE PAPEL FILTRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "13.71", "subtotal": "13.71", "tax": "2.19", "other_taxes": null, "total": "15.9", "cucop_description": "PAPEL FILTRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0035", "description": "CHAROLA PARA HORNEAR DE ALUMINIO - 13 X 18 X 1\", MEDIA CHAROLA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4744.71", "subtotal": "4744.71", "tax": "759.15", "other_taxes": null, "total": "5503.86", "cucop_description": "PORTA OBJETOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0035", "description": "PRENSA PARA TORTILLAS, 15.24 CM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "864.96", "subtotal": "864.96", "tax": "138.39", "other_taxes": null, "total": "1003.35", "cucop_description": "PORTA OBJETOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0035", "description": "RODILLO DE MADERA DE 17.6 PULGADAS PARA HORNEAR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "996.47", "subtotal": "996.47", "tax": "159.44", "other_taxes": null, "total": "1155.91", "cucop_description": "PORTA OBJETOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0035", "description": "PALA MISERABLE SILICON", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "129.31", "subtotal": "129.31", "tax": "20.69", "other_taxes": null, "total": "150", "cucop_description": "PORTA OBJETOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0035", "description": "BOWL, TAZÓN DE ACERO INOXIDABLE MEDIANO DE 28CM X 11.5CM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "194.59", "subtotal": "194.59", "tax": "31.13", "other_taxes": null, "total": "225.72", "cucop_description": "PORTA OBJETOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2023-00071321", "internal_reference": "CP-VER-PD-AD-018/2023", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LAB.", "status": "PUBLICADO", "contractor": { "name": "Q.T.H. INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD SA DE CV", "normalized_name": "QTH INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD", "rfc_type": null, "slug": "qth-insumos-y-servicios-para-la-industria-y-salud" }, "contract_period": { "published_at": "2023-07-11T18:20:11.000Z", "starts_at": "2023-07-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "93459.71", "tax": "14953.55", "total": "108413.26", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0048", "description": "ÁCIDO FOSFOMOLIBDICO PRESENTACIÓN DE 500 GR", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3045.75", "subtotal": "3045.75", "tax": "487.32", "other_taxes": null, "total": "3533.07", "cucop_description": "ABRASIVOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0050", "description": "ÁCIDO HEXANÓICO DE 1 KILO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5467.5", "subtotal": "5467.5", "tax": "874.8", "other_taxes": null, "total": "6342.3", "cucop_description": "DESEMULSIONANTE", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0051", "description": "ÁCIDO LACTICO AL 88% PRESENTACIÓN 1 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1303", "subtotal": "1303", "tax": "208.48", "other_taxes": null, "total": "1511.48", "cucop_description": "ETHER", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0052", "description": "ÁCIDO NÍTRICO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "637", "subtotal": "637", "tax": "101.92", "other_taxes": null, "total": "738.92", "cucop_description": "GLICERINA", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGUA OXIGENADA 1 LITRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "52.5", "subtotal": "52.5", "tax": "8.4", "other_taxes": null, "total": "60.9", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE POTASIO (KCL) FRASCO DE 100 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "136", "subtotal": "136", "tax": "21.76", "other_taxes": null, "total": "157.76", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CLORURO DE POTASIO R.A. 2.5 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1721", "subtotal": "1721", "tax": "275.36", "other_taxes": null, "total": "1996.36", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓXIDO DE POTASIO GRADO ANALÍTICO FRASCO DE 500 GRAMOS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "269", "subtotal": "269", "tax": "43.04", "other_taxes": null, "total": "312.04", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "HIDRÓXIDO DE SODIO PRESENTACIÓN 500 GR POLVO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "532", "subtotal": "532", "tax": "85.12", "other_taxes": null, "total": "617.12", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "KIT CEC-CI (COLIFORM&E. COLI COLOR INDICATOR)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8281", "subtotal": "8281", "tax": "1324.96", "other_taxes": null, "total": "9605.96", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "LINALOOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3767.4", "subtotal": "3767.4", "tax": "602.78", "other_taxes": null, "total": "4370.18", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR PARA ADN. BH 50BP DNA LADDER RTU. (17 BANDS, 50-1,500BPS) CODIGO DM012-R500. 500 MICROLITROS.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "6934.79", "subtotal": "6934.79", "tax": "1109.57", "other_taxes": null, "total": "8044.36", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE CULTIVO PDA. FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1445.89", "subtotal": "1445.89", "tax": "231.34", "other_taxes": null, "total": "1677.23", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO DE CULTIVO TCBS. PARA CRECIMIENTO DE VIBRIOS. FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2928.33", "subtotal": "2928.33", "tax": "468.53", "other_taxes": null, "total": "3396.86", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "QUELATO DE HIERRO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "350", "subtotal": "350", "tax": "56", "other_taxes": null, "total": "406", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "QUITOSANO EN POLVO DE ALTA DENSIDAD GRADO ALIMENTICIO PRESENTACIÓN DE 1 KG", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "300", "subtotal": "300", "tax": "48", "other_taxes": null, "total": "348", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO FOLIN-CIOCALTEU FENOL REAGENT, \"N 500 ML,", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3549", "subtotal": "3549", "tax": "567.84", "other_taxes": null, "total": "4116.84", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA AMONIO RANGO MEDIO HI93715-01 CAJA CON 100 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1248", "subtotal": "1248", "tax": "199.68", "other_taxes": null, "total": "1447.68", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA POTASIO RANGO MEDIO HI93750A-0 CAJA CON 100 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3000", "subtotal": "3000", "tax": "480", "other_taxes": null, "total": "3480", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA POTASIO RANGO MEDIO HI93750B-0 CAJA CON 100 SOBRES", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3000", "subtotal": "3000", "tax": "480", "other_taxes": null, "total": "3480", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVO PARA SULFATO RANGO MEDIO HI93751-01 CAJA CON 100 PBAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1104", "subtotal": "1104", "tax": "176.64", "other_taxes": null, "total": "1280.64", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "REACTIVOS PARA NITRITOS , PAQUETE CON 100 REACTIVOS HI93708-01", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "912", "subtotal": "912", "tax": "145.92", "other_taxes": null, "total": "1057.92", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ROJO CONGO 25 G G PARA USO MICROBIOLÓGICO.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "995.4", "subtotal": "995.4", "tax": "159.26", "other_taxes": null, "total": "1154.66", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "STANDAR CONDUCTIVIDAD ELECTRICA 1413 µS/CM 500ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "360", "subtotal": "360", "tax": "57.6", "other_taxes": null, "total": "417.6", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "TIODIGLICOL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2448", "subtotal": "2448", "tax": "391.68", "other_taxes": null, "total": "2839.68", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "CATALIZADORES KJELDAHL PARA LA DETECCIÓN DEL NITRÓGENO PRESENTACIÓN 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "7488", "subtotal": "7488", "tax": "1198.08", "other_taxes": null, "total": "8686.08", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BICARBONATO DE SODIO PVO. 500 GRS. 3506-01", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "421", "subtotal": "421", "tax": "67.36", "other_taxes": null, "total": "488.36", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0092", "description": "BARRA MAGNETICA MICRO SIN ANILLO RECUBIERTA DE TEFLON 7X2 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "130", "subtotal": "130", "tax": "20.8", "other_taxes": null, "total": "150.8", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0107", "description": "CRONÓMETRO DE FACIL USO 1 S A 99 MIN, 59 S.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "550", "subtotal": "550", "tax": "88", "other_taxes": null, "total": "638", "cucop_description": "CRONOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "ELECTRODO C.E. HI76310", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "8544", "subtotal": "8544", "tax": "1367.04", "other_taxes": null, "total": "9911.04", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0088", "description": "ELECTROLYTE SOLUCION HI7071", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1512", "subtotal": "1512", "tax": "241.92", "other_taxes": null, "total": "1753.92", "cucop_description": "REACTIVOS QUIMICOS PARA USO DE LABORATORIO DE MEDICION", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0123", "description": "EQUIPO DE EXTRACCION SOXHLET MATRAZ 250 ML.EBULLICION, CONDENSADOR ALLIHN, JUNTA INFERIOR 24/40, SUPERIOR 45/50, ALTURA APROX. 711 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4500", "subtotal": "4500", "tax": "720", "other_taxes": null, "total": "5220", "cucop_description": "EXTRACTOR SOXHLET", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "FRASCOS ÁMBAR DE 50 ML CON TAPA", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "35", "subtotal": "35", "tax": "5.6", "other_taxes": null, "total": "40.6", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0102", "description": "HEMATOCÍMETRO O CÁMARA DE NEUBAUER. PARA DETERMINAR LA CONCENTRACIÓN DE CÉLULAS EN UN MEDIO LÍQUIDO. INCLUYA DOS PORTAOBJETOS PARA EL HEMATOCITÓMETRO CON ESPESOR DE 0.4 MM. 0.100 MM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2347.65", "subtotal": "2347.65", "tax": "375.62", "other_taxes": null, "total": "2723.27", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0102", "description": "LUXÓMETRO O EXPOSÍMETRO. MIDA MÍNIMO DE 0 A 50,000 LUXES. CUENTE CON INDICADOR DE BATERÍA BAJA Y TEMPORIZADOR PARA APAGADO AUTOMÁTICO.INCLUYA BATERÍA Y ESTUCHE.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "898.5", "subtotal": "898.5", "tax": "143.76", "other_taxes": null, "total": "1042.26", "cucop_description": "EQUIPO PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRACES ERLENMEYER DE 500 MILILITROS TIPO A", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "114", "subtotal": "114", "tax": "18.24", "other_taxes": null, "total": "132.24", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "220.8", "subtotal": "220.8", "tax": "35.33", "other_taxes": null, "total": "256.13", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 25 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "238.8", "subtotal": "238.8", "tax": "38.21", "other_taxes": null, "total": "277.01", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 5 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "217.2", "subtotal": "217.2", "tax": "34.75", "other_taxes": null, "total": "251.95", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ VOLUMETRICO DE VIDRIO CLASE A 50 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "270", "subtotal": "270", "tax": "43.2", "other_taxes": null, "total": "313.2", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 20 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "238.8", "subtotal": "238.8", "tax": "38.21", "other_taxes": null, "total": "277.01", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 30 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "238.8", "subtotal": "238.8", "tax": "38.21", "other_taxes": null, "total": "277.01", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 300ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "402", "subtotal": "402", "tax": "64.32", "other_taxes": null, "total": "466.32", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0024", "description": "MATRAZ AFORADO 40 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "270", "subtotal": "270", "tax": "43.2", "other_taxes": null, "total": "313.2", "cucop_description": "MATRAZ", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0026", "description": "MICROPIPETA VOL VARIABLE 1000-10000 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3907", "subtotal": "3907", "tax": "625.12", "other_taxes": null, "total": "4532.12", "cucop_description": "MICROPIPETAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0027", "description": "MORTERO DE PORCELANA CON PISTILO DE 65 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "125", "subtotal": "125", "tax": "20", "other_taxes": null, "total": "145", "cucop_description": "MORTERO DE LABORATORIO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0027", "description": "MORTERO CON PISTILO DE PORCELANA CON LABIO DE 50 ML (MEDIDAS 70 MM X 47 MM DE DIÁMETRO INTERNO).", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "125", "subtotal": "125", "tax": "20", "other_taxes": null, "total": "145", "cucop_description": "MORTERO DE LABORATORIO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0027", "description": "MORTERO CON PISTILO DE PORCELANA CON LABIO DE 65 O 80 ML (MEDIDASAPROX. 80 MM X 53 MM DE DIÁMETRO INTERNO)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "125", "subtotal": "125", "tax": "20", "other_taxes": null, "total": "145", "cucop_description": "MORTERO DE LABORATORIO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0094", "description": "PICNOMETRO CALIBRADO DE 50 ML. PICNÓMETROS SON FABRICADO EN VIDRIO SEGÚN LA NORMA ISO 3507. TANTO EL CUERPO COMO EL TAPÓN LLEVAN EL MISMO NÚMERO DE CÓDIGO DE IDENTIFICACIÓN. CALIBRADO JUNTO CON EL TAPÓN CON UNA PRECISIÓN DE 0,001 ML.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "475", "subtotal": "475", "tax": "76", "other_taxes": null, "total": "551", "cucop_description": "SENSOR OPTICO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS DE DISECCION LARGAS DE 30CM", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "105", "subtotal": "105", "tax": "16.8", "other_taxes": null, "total": "121.8", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PINZAS PARA REFRIGERANTE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "275", "subtotal": "275", "tax": "44", "other_taxes": null, "total": "319", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETAS GRADUADAS DE VIDRIO, 10 ML , TIPO O CLASE \"A\"", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "223.3", "subtotal": "223.3", "tax": "35.73", "other_taxes": null, "total": "259.03", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETAS GRADUADAS DE VIDRIO, 100 ML , TIPO O CLASE \"A\"", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "286", "subtotal": "286", "tax": "45.76", "other_taxes": null, "total": "331.76", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETAS GRADUADAS DE VIDRIO, 25 ML , TIPO O CLASE \"A\"", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "228.8", "subtotal": "228.8", "tax": "36.61", "other_taxes": null, "total": "265.41", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0080", "description": "PROBETAS GRADUADAS DE VIDRIO, 50 ML , TIPO O CLASE \"A\"", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "266.8", "subtotal": "266.8", "tax": "42.69", "other_taxes": null, "total": "309.49", "cucop_description": "PINZAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMÓMETRO DE MERCURIO PARA LABORATORIO, FONDO AMARILLO. DE -20 A 110 C. DIVISIÓN DE UN GRADO. LONGITUD DE 322 MM. INMERSION TOTAL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "500.3", "subtotal": "500.3", "tax": "80.05", "other_taxes": null, "total": "580.35", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TÉRMOMETRO DE PERMACOLOR PARA LABORATORIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "518.7", "subtotal": "518.7", "tax": "82.99", "other_taxes": null, "total": "601.69", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TÉRMOMETRO DE PERMACOLOR PARA LABORATORIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "518.7", "subtotal": "518.7", "tax": "82.99", "other_taxes": null, "total": "601.69", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0096", "description": "TERMOMETRO DE VIDRIO DE -100 A 50", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "270", "subtotal": "270", "tax": "43.2", "other_taxes": null, "total": "313.2", "cucop_description": "TERMOMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO 100 ML TIPO A", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "55", "subtotal": "55", "tax": "8.8", "other_taxes": null, "total": "63.8", "cucop_description": "VASOS COMUNICANTES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 10 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "45", "subtotal": "45", "tax": "7.2", "other_taxes": null, "total": "52.2", "cucop_description": "VASOS COMUNICANTES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 100 ML 1 CAJA CON 50", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2600", "subtotal": "2600", "tax": "416", "other_taxes": null, "total": "3016", "cucop_description": "VASOS COMUNICANTES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 2000 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "276", "subtotal": "276", "tax": "44.16", "other_taxes": null, "total": "320.16", "cucop_description": "VASOS COMUNICANTES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 50 MILILITROS TIPO A", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "55", "subtotal": "55", "tax": "8.8", "other_taxes": null, "total": "63.8", "cucop_description": "VASOS COMUNICANTES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0053", "description": "VASOS DE PRECIPITADO DE 50 ML PAQUETE CON 50", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "55", "subtotal": "55", "tax": "8.8", "other_taxes": null, "total": "63.8", "cucop_description": "VASOS COMUNICANTES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2023-00071327", "internal_reference": "CP-VER-PD-AD-019/2023", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LAB.", "status": "PUBLICADO", "contractor": { "name": "UNIPARTS SA DE CV", "normalized_name": "UNIPARTS", "rfc_type": null, "slug": "uniparts" }, "contract_period": { "published_at": "2023-07-11T18:22:06.000Z", "starts_at": "2023-07-14T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "114342.38", "tax": "18294.78", "total": "132637.16", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0038", "description": "ACCESS RT-PCR SYSTEM KIT DE 500 MUESTRAS", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "70093.6902", "subtotal": "70093.69", "tax": "11214.99", "other_taxes": null, "total": "81308.68", "cucop_description": "RESINAS QUIMICAS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0059", "description": "AGAR BACTERIOLÓGICO. FRASCO CON 500 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2184.2881", "subtotal": "2184.29", "tax": "349.49", "other_taxes": null, "total": "2533.77", "cucop_description": "SULFURO DE SODIO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0060", "description": "AGAR CEREBRO CORAZON FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1746.5316", "subtotal": "1746.53", "tax": "279.45", "other_taxes": null, "total": "2025.98", "cucop_description": "TIOSULFATO DE SODIO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0061", "description": "AGAR MÉTODOS ESTANDAR FRASCO 450G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1354.6182", "subtotal": "1354.62", "tax": "216.74", "other_taxes": null, "total": "1571.36", "cucop_description": "CLORURO DE POTASIO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0062", "description": "AGAR NUTRITIVO FRASCO (450GR)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1587.4291", "subtotal": "1587.43", "tax": "253.99", "other_taxes": null, "total": "1841.42", "cucop_description": "AGUA DESIONIZADA", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0063", "description": "AGAR PAPA DEXTROSA PDA FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1117.3128", "subtotal": "1117.31", "tax": "178.77", "other_taxes": null, "total": "1296.08", "cucop_description": "AGUA BIDESTILADA", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGAROSA ULTRA PURA 100 GRAMOS. GRADO BIOLOGÍA MOLECULAR.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1719.1157", "subtotal": "1719.12", "tax": "275.06", "other_taxes": null, "total": "1994.17", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BUFFER DE CARGA PARA ELECTROFORESIS DE 1 ML", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1063.25", "subtotal": "1063.25", "tax": "170.12", "other_taxes": null, "total": "1233.37", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "COLORANTE PARA TEÑIR ÁCIDOS NUCLEICOS GEL RED® 10 000 X 0.5 ML.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1113.57", "subtotal": "1113.57", "tax": "178.17", "other_taxes": null, "total": "1291.74", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "COLORANTE PARA TEÑIR GELES DE ELECTROFORESIS (SUSTITUTO DE BROMURO DE ETIDIO) DE 500 µL", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2312.57", "subtotal": "2312.57", "tax": "370.01", "other_taxes": null, "total": "2682.58", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "D-GLUCOSA ANHIDRA ACS (DEXTROSA) PARA MICROBIOLOGÍA (MEDIO DE CULTIVO). FRASCO DE 250 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "397.52", "subtotal": "397.52", "tax": "63.6", "other_taxes": null, "total": "461.12", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA DNA POLIMERASA GOTAQ® FLEXI DNA. PARA AMPLIFICACIÓN DE ADN POR PCR. 500 UNIDADES.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2349.46", "subtotal": "2349.46", "tax": "375.91", "other_taxes": null, "total": "2725.37", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ENZIMA TAQ POLIMERASA. 500 UNIDADES. LA BIOLASA (ADN POLIMERASA)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2349.46", "subtotal": "2349.46", "tax": "375.91", "other_taxes": null, "total": "2725.37", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ESCALERA BAJA PCR 20 PB, PARA ELECTROPHORESIS DE FRAGMNETOS DE PCR CON 40 µG.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "4102.76", "subtotal": "4102.76", "tax": "656.44", "other_taxes": null, "total": "4759.2", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "EXTRACTO DE LEVADURA. MEDIO DE CULTIVO BACTERIOLÓGICO. FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1159.56", "subtotal": "1159.56", "tax": "185.53", "other_taxes": null, "total": "1345.09", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "EXTRACTO DE LEVADURA. MEDIO DE CULTIVO PARA MICROBIOLOGÍA. FRASCO DE 500 G.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1159.56", "subtotal": "1159.56", "tax": "185.53", "other_taxes": null, "total": "1345.09", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "MARCADOR DE PESO MOLECULAR PARA GELES DE ADN: BH 100 BP DNA LADDER RTU. DM001-R500. 500 MICROLITROS (11 BANDS, 100-1,500BPS)", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "2944.74", "subtotal": "2944.74", "tax": "471.16", "other_taxes": null, "total": "3415.9", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "MEDIO PDA MCD-LAB CAT. 7041", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1014.84", "subtotal": "1014.84", "tax": "162.37", "other_taxes": null, "total": "1177.21", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "NITRATO DE CALCIO", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "259.04", "subtotal": "259.04", "tax": "41.45", "other_taxes": null, "total": "300.49", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "PCR CORE KIT WITH TAQ DNA POLYMERASE", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "3944.82", "subtotal": "3944.82", "tax": "631.17", "other_taxes": null, "total": "4575.99", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "PEPTONA EXTRACTO DE CARNE FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1604.51", "subtotal": "1604.51", "tax": "256.72", "other_taxes": null, "total": "1861.23", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SET DE DNTPS PARA PCR POR SEPARADO. 4 X 25 UMOL (4X250UL)/ 4 X 100 UMOL (4X1ML) / 4 X 100 UMOL (4X4X250UL) / 4 X 500 UMOL (4X5X1 ML) / 4 X 1000 UMOL (4×10 ML). EL SET CONSISTE EN CUATRO SOLUCIONES 100 MM SEPARADAS DE: DATP, DCTP, DGTP Y DTTP RESPECTIVAMENTE. ULTRAPURO: >99% TRIFOSFATO POR HPLC.", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "5980.79", "subtotal": "5980.79", "tax": "956.93", "other_taxes": null, "total": "6937.72", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIPTONA (DIGERIDO PANCREÁTICO DE CASEÍNA) 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1391.47", "subtotal": "1391.47", "tax": "222.64", "other_taxes": null, "total": "1614.11", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "TRIPTONA. MEDIO DE CULTIVO BACTERIOLÓGICO. FRASCO DE 500 G", "unit": "PIEZA", "requested_quantity": null, "awarded_quantity": null, "unit_price": "1391.47", "subtotal": "1391.47", "tax": "222.64", "other_taxes": null, "total": "1614.11", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "JUSTIFICACIÓN DE EXCEPCIÓN", "filename": "2 CAAS JUSTIFICACION  EN TERMINOS DEL ART 71 DEL REGLAMENTO DE LA LEY DE ADQUISICIONES_OK.pdf", "availability": "available", "size_bytes": "17099176", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:25.514Z", "updated_at": "2025-12-07T13:09:25.515Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "2 ANEXO TECNICO ADQUISICIÿN DE REACTIVOS QUIMICOS-MATERIALES Y ACCESORIOS DE LABORATORIO CVER.pdf", "availability": "available", "size_bytes": "11508293", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:33.785Z", "updated_at": "2025-12-07T13:09:33.786Z" }, { "id": null, "annex_number": 4, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "OFICIO DE ADJUDICACIÿN A PROVEEDOR ALPHALAB_OK_S.pdf", "availability": "available", "size_bytes": "969659", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:35.869Z", "updated_at": "2025-12-07T13:09:35.870Z" }, { "id": null, "annex_number": 5, "document_type": null, "description": "ANEXOS OFICIO DE ADJUDICACIÓN", "filename": "XVII. COMERCIALIZADORA ALPHALAB S DE RL DE CV.pdf", "availability": "available", "size_bytes": "3217513", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:38.423Z", "updated_at": "2025-12-07T13:09:38.424Z" }, { "id": null, "annex_number": 6, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "OFICIO DE ADJUDICACIÿN QTH INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD.pdf", "availability": "available", "size_bytes": "936852", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:39.774Z", "updated_at": "2025-12-07T13:09:39.776Z" }, { "id": null, "annex_number": 7, "document_type": null, "description": "ANEXOS OFICIO DE ADJUDICACIÓN", "filename": "XVIII. QTH INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD (1).pdf", "availability": "available", "size_bytes": "3156645", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:42.249Z", "updated_at": "2025-12-07T13:09:42.250Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "OFICIO DE ADJUDICACIÿN UNIPARTS SA DE CV.pdf", "availability": "available", "size_bytes": "937145", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:44.023Z", "updated_at": "2025-12-07T13:09:44.024Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "ANEXOS OFICIO DE ADJUDICACIÓN", "filename": "XIX. UNIPARTS.pdf", "availability": "available", "size_bytes": "2915175", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-07T13:09:49.350Z", "updated_at": "2025-12-07T13:09:49.351Z" } ], "provenance": { "source_system": "Compras MX", "source_fetched_at": "2026-07-28T11:01:08.111Z", "last_seen_at": "2026-07-28T11:01:08.034Z", "first_seen_at": "2025-11-05T04:52:34.071Z", "detail_complete": true, "documents_complete": true, "content_changed_at": "2025-11-05T04:52:34.071Z" }, "context": { "prices": [ { "cucop_code": "25101-0037", "description": "REACTIVOS ANALITICOS", "priced_items": 44908, "units": [ { "n": 37743, "max": 280215502.56, "min": 0.53, "p10": 257, "p50": 3160, "p90": 19101.912, "unidad": "PIEZA" }, { "n": 3116, "max": 389753, "min": 2.25, "p10": 400, "p50": 2371.685, "p90": 18751.455, "unidad": "LITRO" }, { "n": 2930, "max": 1567806.8, "min": 1, "p10": 120, "p50": 3200, "p90": 17597.42, "unidad": "UNIDAD" }, { "n": 249, "max": 111832796, "min": 3.81, "p10": 885.8, "p50": 31540, "p90": 8964611.16, "unidad": "SERVICIO" }, { "n": 204, "max": 48058.42, "min": 140, "p10": 516.839, "p50": 15109.01, "p90": 33997.005, "unidad": "MILILITRO" }, { "n": 147, "max": 66620.51, "min": 0.75, "p10": 294.948, "p50": 1414, "p90": 7859.608, "unidad": "GRAMO" }, { "n": 142, "max": 68318.25, "min": 12.93, "p10": 72.992, "p50": 895.05, "p90": 5181.9, "unidad": "KILOGRAMO" }, { "n": 142, "max": 24971469.93, "min": 18, "p10": 1215.2, "p50": 65495.585, "p90": 457938.306, "unidad": "LOTE" }, { "n": 65, "max": 33900, "min": 208, "p10": 647.412, "p50": 2063.45, "p90": 5323.4, "unidad": "GALON" }, { "n": 59, "max": 120750, "min": 58.5, "p10": 112.396, "p50": 1561.88, "p90": 13849.984, "unidad": "TESLA" }, { "n": 58, "max": 21600, "min": 16.04, "p10": 22.329, "p50": 110.985, "p90": 691, "unidad": "METRO CUBICO" }, { "n": 28, "max": 12722.17, "min": 119, "p10": 698.229, "p50": 1903.5, "p90": 4866.035, "unidad": "MILIGRAMO" }, { "n": 25, "max": 103489.92, "min": 1617, "p10": 11250.8, "p50": 14200.9, "p90": 57843.788, "unidad": "KILOGRAMO POR HORA" } ], "price_by_year": { "2023": { "n": 14653, "p50": 2420 }, "2024": { "n": 13438, "p50": 3500 }, "2025": { "n": 8626, "p50": 4177.3 }, "2026": { "n": 8191, "p50": 2958 } }, "refreshed_at": "2026-09-24T05:35:01.565Z" }, { "cucop_code": "25101-0039", "description": "SUSTANCIAS QUÍMICAS", "priced_items": 5904, "units": [ { "n": 3993, "max": 30500538.36, "min": 1.9, "p10": 306.8, "p50": 3281.32, "p90": 19258.22, "unidad": "PIEZA" }, { "n": 1355, "max": 642600, "min": 6.05, "p10": 450, "p50": 2720, "p90": 26099.6, "unidad": "LITRO" }, { "n": 155, "max": 2395012.5, "min": 1.35, "p10": 9.356, "p50": 52.5, "p90": 1305, "unidad": "KILOGRAMO" }, { "n": 132, "max": 1463208.65, "min": 29.83, "p10": 1437.021, "p50": 7354.25, "p90": 157025.631, "unidad": "LOTE" }, { "n": 110, "max": 2625000, "min": 21, "p10": 99, "p50": 2585, "p90": 60875, "unidad": "METRO CUBICO" }, { "n": 70, "max": 15836, "min": 175, "p10": 409.036, "p50": 1500.395, "p90": 7147.131, "unidad": "GRAMO" }, { "n": 26, "max": 302400, "min": 354.33, "p10": 736.005, "p50": 2500, "p90": 21241.245, "unidad": "UNIDAD" }, { "n": 20, "max": 8400, "min": 70, "p10": 420.617, "p50": 1069, "p90": 5948.7, "unidad": "GALON" }, { "n": 17, "max": 3675066, "min": 1850, "p10": 12435.324, "p50": 90103, "p90": 1836652.32, "unidad": "SERVICIO" }, { "n": 11, "max": 7862, "min": 666.77, "p10": 970, "p50": 3644, "p90": 7862, "unidad": "MILILITRO" }, { "n": 7, "max": 180000, "min": 2700, "p10": 5280, "p50": 10000, "p90": 126600, "unidad": "KILOGRAMO KELVIN" }, { "n": 4, "max": 15640.37, "min": 9.59, "p10": 3132.713, "p50": 11725, "p90": 14857.259, "unidad": "TONELADA METRICA" }, { "n": 3, "max": 6599.7, "min": 1357.5, "p10": 1720.432, "p50": 3172.16, "p90": 5914.192, "unidad": "MILIGRAMO" } ], "price_by_year": { "2023": { "n": 100, "p50": 558.85 }, "2024": { "n": 1524, "p50": 2871 }, "2025": { "n": 1642, "p50": 2200 }, "2026": { "n": 2638, "p50": 3678 } }, "refreshed_at": "2026-09-27T18:45:02.020Z" }, { "cucop_code": "25101-0040", "description": "SULFATO DE AMONIO", "priced_items": 50, "units": [ { "n": 40, "max": 25622, "min": 30, "p10": 463, "p50": 1200.665, "p90": 2499.277, "unidad": "PIEZA" }, { "n": 5, "max": 986, "min": 312, "p10": 438.532, "p50": 700, "p90": 889.6, "unidad": "GRAMO" } ], "price_by_year": { "2023": { "n": 12, "p50": 1813.565 }, "2024": { "n": 22, "p50": 1133.445 }, "2025": { "n": 11, "p50": 700 }, "2026": { "n": 5, "p50": 1838.82 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0041", "description": "HULE SINTETICO Y ELASTOMEROS", "priced_items": 89, "units": [ { "n": 85, "max": 254171.25, "min": 4.52, "p10": 242.8, "p50": 1510, "p90": 5974.13, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 23, "p50": 1750 }, "2024": { "n": 57, "p50": 1510 }, "2025": { "n": 2, "p50": 107756.75 }, "2026": { "n": 7, "p50": 198 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0042", "description": "PASTA AL SULFATO", "priced_items": 43, "units": [ { "n": 39, "max": 61573, "min": 1, "p10": 77.44, "p50": 2565, "p90": 7902.7, "unidad": "PIEZA" }, { "n": 4, "max": 9205.88, "min": 2050, "p10": 2050, "p50": 2050, "p90": 7059.116, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 12, "p50": 2510.335 }, "2024": { "n": 1, "p50": 1738.03 }, "2025": { "n": 3, "p50": 9205.88 }, "2026": { "n": 27, "p50": 2500 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0043", "description": "PASTA DE BAGAZO VISCOSA", "priced_items": 12, "units": [ { "n": 11, "max": 2129, "min": 18.75, "p10": 120, "p50": 150, "p90": 2071, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 10, "p50": 150 }, "2024": { "n": 1, "p50": 6628 }, "2026": { "n": 1, "p50": 999.13 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0044", "description": "PASTA MECANICA", "priced_items": 10, "units": [ { "n": 10, "max": 14850, "min": 339.33, "p10": 1925.382, "p50": 6819.5, "p90": 11385, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 6, "p50": 3400 }, "2025": { "n": 3, "p50": 7500 }, "2026": { "n": 1, "p50": 14850 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0046", "description": "PULIMENTOS Y LUSTRADORES", "priced_items": 132, "units": [ { "n": 129, "max": 32373, "min": 93.85, "p10": 1098.028, "p50": 1545.62, "p90": 5278.97, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 9, "p50": 2265 }, "2024": { "n": 120, "p50": 1550.12 }, "2025": { "n": 1, "p50": 47.59 }, "2026": { "n": 2, "p50": 96.42 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0047", "description": "SULFATO DE ALUMINIO", "priced_items": 56, "units": [ { "n": 43, "max": 7100, "min": 50, "p10": 365, "p50": 663.12, "p90": 5371.84, "unidad": "PIEZA" }, { "n": 11, "max": 27886.5, "min": 11.05, "p10": 11.95, "p50": 260, "p90": 12896.1, "unidad": "KILOGRAMO" } ], "price_by_year": { "2023": { "n": 10, "p50": 3572.995 }, "2024": { "n": 25, "p50": 663.12 }, "2025": { "n": 12, "p50": 391.8 }, "2026": { "n": 9, "p50": 432 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0049", "description": "COMPUESTO QUIMICO", "priced_items": 9641, "units": [ { "n": 6803, "max": 446857.16, "min": 0.18, "p10": 210, "p50": 2220.54, "p90": 14850, "unidad": "PIEZA" }, { "n": 1458, "max": 234303.56, "min": 7.11, "p10": 262.741, "p50": 3321, "p90": 27897.261, "unidad": "LITRO" }, { "n": 417, "max": 107500, "min": 1.27, "p10": 13.99, "p50": 117.45, "p90": 1336.656, "unidad": "KILOGRAMO" }, { "n": 270, "max": 77586.21, "min": 72.08, "p10": 163.368, "p50": 2182.08, "p90": 12455.3, "unidad": "UNIDAD" }, { "n": 227, "max": 551727.59, "min": 46.64, "p10": 1238.41, "p50": 7942, "p90": 34884.178, "unidad": "LOTE" }, { "n": 225, "max": 28382.84, "min": 0.01, "p10": 0.6373, "p50": 830, "p90": 2675.328, "unidad": "GRAMO" }, { "n": 110, "max": 21415.86, "min": 0.01, "p10": 0.05, "p50": 119.92, "p90": 3655.8, "unidad": "MILILITRO" }, { "n": 79, "max": 179860, "min": 22, "p10": 274, "p50": 2340, "p90": 19000, "unidad": "METRO CUBICO" }, { "n": 26, "max": 16211, "min": 73, "p10": 120, "p50": 303.5, "p90": 2500.125, "unidad": "GALON" }, { "n": 17, "max": 35301000, "min": 95, "p10": 408, "p50": 77586.21, "p90": 8725440.398, "unidad": "SERVICIO" }, { "n": 3, "max": 7864, "min": 2271.25, "p10": 2292.4, "p50": 2377, "p90": 6766.6, "unidad": "MILIGRAMO" }, { "n": 3, "max": 13.99, "min": 13.99, "p10": 13.99, "p50": 13.99, "p90": 13.99, "unidad": "KILOMETRO" } ], "price_by_year": { "2023": { "n": 4558, "p50": 3176.215 }, "2024": { "n": 2176, "p50": 1743 }, "2025": { "n": 1994, "p50": 1379.41 }, "2026": { "n": 913, "p50": 1092 } }, "refreshed_at": "2026-09-25T21:00:03.055Z" }, { "cucop_code": "25101-0053", "description": "POLIURETANO", "priced_items": 25, "units": [ { "n": 25, "max": 14949, "min": 77.64, "p10": 198.952, "p50": 1724.13, "p90": 6437.158, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 5, "p50": 1840.9 }, "2024": { "n": 16, "p50": 1724.135 }, "2025": { "n": 1, "p50": 227.38 }, "2026": { "n": 3, "p50": 180 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0054", "description": "RODAMINA", "priced_items": 7, "units": [ { "n": 6, "max": 10538, "min": 306.67, "p10": 2271.835, "p50": 6557.87, "p90": 9811.5, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 2, "p50": 5422.335 }, "2024": { "n": 3, "p50": 9085 }, "2026": { "n": 2, "p50": 5292.75 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0055", "description": "SAFRANINA", "priced_items": 40, "units": [ { "n": 28, "max": 170607.5, "min": 43, "p10": 54.915, "p50": 408.695, "p90": 28595.95, "unidad": "PIEZA" }, { "n": 5, "max": 8226.46, "min": 9.621, "p10": 29.3726, "p50": 1209, "p90": 5740.676, "unidad": "KILOGRAMO" }, { "n": 3, "max": 127, "min": 127, "p10": 127, "p50": 127, "p90": 127, "unidad": "LITRO" }, { "n": 3, "max": 170, "min": 55.05, "p10": 64.04, "p50": 100, "p90": 156, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 18, "p50": 81.25 }, "2024": { "n": 8, "p50": 681.015 }, "2025": { "n": 9, "p50": 423.19 }, "2026": { "n": 5, "p50": 1209 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0056", "description": "SULFATO DE SODIO", "priced_items": 114, "units": [ { "n": 74, "max": 7548.7, "min": 86, "p10": 339.2, "p50": 1628, "p90": 5073.6, "unidad": "PIEZA" }, { "n": 23, "max": 7014.78, "min": 10, "p10": 29.6, "p50": 444, "p90": 2312, "unidad": "KILOGRAMO" }, { "n": 8, "max": 2235, "min": 171, "p10": 205.3, "p50": 728.2, "p90": 1637.2, "unidad": "UNIDAD" }, { "n": 4, "max": 940, "min": 298.25, "p10": 307.775, "p50": 336.1, "p90": 760.66, "unidad": "GRAMO" } ], "price_by_year": { "2023": { "n": 56, "p50": 1567 }, "2024": { "n": 19, "p50": 686 }, "2025": { "n": 16, "p50": 692.5 }, "2026": { "n": 23, "p50": 895.5 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0057", "description": "SULFATO DE ZINC", "priced_items": 237, "units": [ { "n": 174, "max": 390187, "min": 58, "p10": 275.871, "p50": 10905.3945, "p90": 26782.6587, "unidad": "UNIDAD" }, { "n": 53, "max": 8620689.66, "min": 119, "p10": 250, "p50": 849.9, "p90": 5984.8, "unidad": "PIEZA" }, { "n": 5, "max": 298.6751, "min": 58, "p10": 59.6, "p50": 94.5, "p90": 227.2051, "unidad": "LITRO" }, { "n": 3, "max": 1943, "min": 344.83, "p10": 411.664, "p50": 679, "p90": 1690.2, "unidad": "KILOGRAMO" } ], "price_by_year": { "2023": { "n": 16, "p50": 890.45 }, "2024": { "n": 201, "p50": 8368.14 }, "2025": { "n": 8, "p50": 347.8 }, "2026": { "n": 12, "p50": 679.5 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25101-0058", "description": "SULFITO DE BISMUTO", "priced_items": 13, "units": [ { "n": 10, "max": 43857, "min": 295.33, "p10": 303.961, "p50": 2243.55, "p90": 31295.7, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 4, "p50": 2568.885 }, "2024": { "n": 5, "p50": 738.67 }, "2025": { "n": 2, "p50": 22080.96 }, "2026": { "n": 2, "p50": 16787.5 } }, "refreshed_at": "2026-09-18T22:37:38.604Z" }, { "cucop_code": "25501-0002", "description": "APARATO PARA DEMOSTRAR LA CONSERVACION DE LA ENERGIA", "priced_items": 143, "units": [ { "n": 135, "max": 261250, "min": 1.1058, "p10": 97.9, "p50": 1400, "p90": 10009.698, "unidad": "PIEZA" }, { "n": 5, "max": 500, "min": 111.3, "p10": 111.3, "p50": 111.3, "p90": 421.272, "unidad": "SERVICIO" } ], "price_by_year": { "2023": { "n": 58, "p50": 727.5 }, "2024": { "n": 36, "p50": 890 }, "2025": { "n": 36, "p50": 2226 }, "2026": { "n": 13, "p50": 2054 } }, "refreshed_at": "2026-09-18T22:38:28.375Z" }, { "cucop_code": "25501-0065", "description": "BANDEJA", "priced_items": 127, "units": [ { "n": 125, "max": 33371.26, "min": 0.62, "p10": 80.82, "p50": 610, "p90": 5129.588, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 65, "p50": 600 }, "2024": { "n": 28, "p50": 169 }, "2025": { "n": 25, "p50": 929.5 }, "2026": { "n": 9, "p50": 4926.03 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0092", "description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "priced_items": 2167, "units": [ { "n": 2001, "max": 2625000, "min": 0.2293, "p10": 79.81, "p50": 780, "p90": 11082.17, "unidad": "PIEZA" }, { "n": 112, "max": 198300, "min": 24, "p10": 109.109, "p50": 1281.5, "p90": 6964.85, "unidad": "UNIDAD" }, { "n": 28, "max": 460678, "min": 125.84, "p10": 2020, "p50": 3550, "p90": 48837.344, "unidad": "LOTE" }, { "n": 14, "max": 2700.9222, "min": 10.69, "p10": 103.044, "p50": 257.315, "p90": 2004.7615, "unidad": "METRO" }, { "n": 10, "max": 25535, "min": 25, "p10": 77.65, "p50": 214.25, "p90": 3228.5, "unidad": "SERVICIO" } ], "price_by_year": { "2023": { "n": 672, "p50": 801 }, "2024": { "n": 456, "p50": 675.23 }, "2025": { "n": 677, "p50": 900 }, "2026": { "n": 362, "p50": 620.5 } }, "refreshed_at": "2026-09-24T21:00:04.571Z" }, { "cucop_code": "25501-0102", "description": "EQUIPO PARA TOMA MULTIPLE", "priced_items": 165, "units": [ { "n": 160, "max": 7110189.16, "min": 5.25, "p10": 100.366, "p50": 1108.155, "p90": 7701.7, "unidad": "PIEZA" }, { "n": 3, "max": 18284, "min": 185, "p10": 338, "p50": 950, "p90": 14817.2, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 80, "p50": 1237 }, "2024": { "n": 45, "p50": 1087 }, "2025": { "n": 31, "p50": 973.33 }, "2026": { "n": 9, "p50": 1360 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0132", "description": "TUBO SALOMÓNICO", "priced_items": 9, "units": [ { "n": 9, "max": 7800, "min": 12, "p10": 153.368, "p50": 1500, "p90": 5916.256, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 3, "p50": 5445.32 }, "2024": { "n": 3, "p50": 2266.11 }, "2025": { "n": 1, "p50": 325 }, "2026": { "n": 2, "p50": 844.355 } }, "refreshed_at": "2026-09-18T22:38:31.345Z" }, { "cucop_code": "25501-0130", "description": "BULBO DE LATEX", "priced_items": 40, "units": [ { "n": 36, "max": 177229.5, "min": 2.9, "p10": 11.5, "p50": 135.5, "p90": 4047.5, "unidad": "PIEZA" }, { "n": 3, "max": 251.21, "min": 69, "p10": 79.2, "p50": 120, "p90": 224.968, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 17, "p50": 108.1 }, "2024": { "n": 10, "p50": 160 }, "2025": { "n": 9, "p50": 173 }, "2026": { "n": 4, "p50": 62 } }, "refreshed_at": "2026-09-18T22:38:31.345Z" }, { "cucop_code": "25501-0122", "description": "ACCESORIOS PARA BUTIROMETRO", "priced_items": 38, "units": [ { "n": 38, "max": 36021.23, "min": 3.54, "p10": 88.724, "p50": 844.945, "p90": 15313.8446, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 5, "p50": 652.4 }, "2024": { "n": 18, "p50": 684.195 }, "2025": { "n": 11, "p50": 954 }, "2026": { "n": 4, "p50": 1351.94 } }, "refreshed_at": "2026-09-18T22:38:31.345Z" }, { "cucop_code": "25501-0005", "description": "CAJA PETRI", "priced_items": 677, "units": [ { "n": 623, "max": 17090476.92, "min": 0.62, "p10": 13.2, "p50": 546, "p90": 4708.136, "unidad": "PIEZA" }, { "n": 32, "max": 22930, "min": 3, "p10": 30, "p50": 1064.065, "p90": 4991.235, "unidad": "UNIDAD" }, { "n": 22, "max": 495134.03, "min": 34, "p10": 424.881, "p50": 17753.265, "p90": 377842.1, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 310, "p50": 534.375 }, "2024": { "n": 128, "p50": 676.97 }, "2025": { "n": 90, "p50": 431.485 }, "2026": { "n": 149, "p50": 1000 } }, "refreshed_at": "2026-09-18T22:38:28.375Z" }, { "cucop_code": "25501-0101", "description": "CAJAS PLASTIFICADAS", "priced_items": 189, "units": [ { "n": 167, "max": 104871.75, "min": 1.69, "p10": 43.112, "p50": 520, "p90": 7048.172, "unidad": "PIEZA" }, { "n": 19, "max": 6380, "min": 323, "p10": 528, "p50": 950, "p90": 3276.456, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 75, "p50": 520 }, "2024": { "n": 55, "p50": 620 }, "2025": { "n": 27, "p50": 1272.32 }, "2026": { "n": 32, "p50": 627.5 } }, "refreshed_at": "2026-09-21T20:00:02.331Z" } ], "suppliers": [ { "slug": "comercializadora-alphalab", "name": "COMERCIALIZADORA ALPHALAB S DE RL DE CV", "total_contracts": 26, "total_awarded_amount": "4014787.63", "median_amount": "107188.03", "distinct_buyers": 6, "first_contract_at": "2023-02-15T00:00:00.000Z", "last_contract_at": "2026-08-07T00:00:00.000Z", "with_this_buyer": { "contracts": 16, "amount": "2847107.97" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "qth-insumos-y-servicios-para-la-industria-y-salud", "name": "Q.T.H. INSUMOS Y SERVICIOS PARA LA INDUSTRIA Y SALUD SA DE CV", "total_contracts": 6, "total_awarded_amount": "1104447.37", "median_amount": "133784.26", "distinct_buyers": 2, "first_contract_at": "2023-04-01T00:00:00.000Z", "last_contract_at": "2026-06-12T00:00:00.000Z", "with_this_buyer": { "contracts": 5, "amount": "945292.12" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "uniparts", "name": "UNIPARTS SA DE CV", "total_contracts": 198, "total_awarded_amount": "38076889.14", "median_amount": "66347.69", "distinct_buyers": 33, "first_contract_at": "2023-02-03T00:00:00.000Z", "last_contract_at": "2025-12-16T00:00:00.000Z", "with_this_buyer": { "contracts": 8, "amount": "2871114.06" }, "refreshed_at": "2026-09-16T00:56:30.797Z" } ], "buyer": { "slug": "colpos", "name": "COLEGIO DE POSTGRADUADOS", "total_procedures": 983, "distinct_suppliers": 511, "procedures_by_type": { "LICITACIÓN PÚBLICA": 84, "ADJUDICACIÓN DIRECTA": 829, "INVITACIÓN A CUANDO MENOS TRES PERSONAS": 62, "CONTRATO ESPECÍFICO DERIVADO DE ACUERDO MARCO": 8 }, "refreshed_at": "2026-09-24T19:00:07.885Z" } }, "alternates": [], "similar": [ { "numero_procedimiento": "aa-08-izc-008izc999-n-141-2023", "nombre_procedimiento": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS, REACTIVOS, MATERIALES Y ACCESORIOS DE LABORAT", "dependencia": "COLPOS", "siglas": "COLPOS", "score": 0.05682194232940674, "anio_ejercicio": 2023, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2023-07-21T11:32:59.000Z", "ganador": "ASESORIA Y PROVEEDORA DE EQUIPOS PARA LABORATORIO SA DE CV", "ganador_slug": "asesoria-y-proveedora-de-equipos-para-laboratorio", "ganador_rfc_type": null, "ganadores": "2", "monto_mxn": "488605.92" }, { "numero_procedimiento": "aa-08-izc-008izc999-n-41-2024", "nombre_procedimiento": "ADQUSICIÓN DE REACTIVOS Y MATERIALES PARA LAS ACTIVIDADES DE APOYO ACADÉMICO", "dependencia": "COLPOS", "siglas": "COLPOS", "score": 0.07883149855324456, "anio_ejercicio": 2024, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2024-03-14T20:59:04.000Z", "ganador": "CONTROL TECNICO Y REPRESENTACIONES SA DE CV", "ganador_slug": "control-tecnico-y-representaciones", "ganador_rfc_type": null, "ganadores": "1", "monto_mxn": "52820.60" }, { "numero_procedimiento": "aa-08-izc-008izc999-n-182-2024", "nombre_procedimiento": "ADQUISICION DE PRODUCTOS QUÍMICOS BÁSICOS Y MATERIALES DE LABORATORIO 2024", "dependencia": "COLEGIO DE POSTGRADUADOS", "siglas": "COLPOS", "score": 0.0793687653917794, "anio_ejercicio": 2024, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2024-05-22T13:31:53.000Z", "ganador": "CARLOS ALBERTO CARBAJAL PIÑA", "ganador_slug": "carlos-alberto-carbajal-pina", "ganador_rfc_type": null, "ganadores": "1", "monto_mxn": "823495.20" }, { "numero_procedimiento": "aa-08-izc-008izc999-n-28-2025", "nombre_procedimiento": "ADQUISICIÓN DE MATERIALES, ACCESORIOS, SUMINISTROS Y REACTIVOS DE LABORATORIO", "dependencia": "COLEGIO DE POSTGRADUADOS", "siglas": "COLPOS", "score": 0.0831776211751909, "anio_ejercicio": 2025, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2025-03-22T19:00:34.000Z", "ganador": "DIKYSA SA DE CV", "ganador_slug": "dikysa", "ganador_rfc_type": null, "ganadores": "9", "monto_mxn": "1652474.90" }, { "numero_procedimiento": "aa-08-izc-008izc999-n-107-2025", "nombre_procedimiento": "ADQ. DE REAC Y MAT DE LAB PARA LA AAA CAMPUS TABASCO 2025", "dependencia": "COLPOS", "siglas": "COLPOS", "score": 0.09421038627624512, "anio_ejercicio": 2025, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2025-06-23T18:34:52.000Z", "ganador": "FERANDELH SA DE CV", "ganador_slug": "ferandelh", "ganador_rfc_type": null, "ganadores": "6", "monto_mxn": "665779.58" }, { "numero_procedimiento": "aa-08-izc-008izc999-n-59-2024", "nombre_procedimiento": "ADQUISICIÓN DE MATERIALES Y REACTIVOS PARA LABORATORIO CAMPUS PUEBLA", "dependencia": "COLPOS", "siglas": "COLPOS", "score": 0.0959803788656105, "anio_ejercicio": 2024, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2024-04-01T11:07:40.000Z", "ganador": "ACCESORIOS PARA LABORATORIOS SA DE CV", "ganador_slug": "accesorios-para-laboratorios", "ganador_rfc_type": null, "ganadores": "7", "monto_mxn": "1650000.00" } ] }