{ "html_url": "https://postor.com.mx/adjudicacion/aa-08-b00-008b00001-n-57-2023", "canonical": "https://postor.com.mx/adjudicacion/aa-08-b00-008b00001-n-57-2023", "id": "58ccf6242e924812b4a44fe414809100", "procedure_number": "AA-08-B00-008B00001-N-57-2023", "file_number": "E-2023-00039318", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "description": { "short": "No existen bienes alternativos o sustitutos, Único Oferente, Derechos exclusivos (patentes, licencias, derechos de autor u otros derechos exclusivos), o por obras de arte.", "detailed": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO DE LAS MARCAS AGILENT, APPLIED BIOSYSTEMS, ATCC, BIOMERIEUX, EUROFINS ABRAXIS, EUROPROXIMA, HYGIENA, IDT, INVITROGEN, PROMEGA, RANDOX, R-BIOPHARM, ROCHE, THERMO FISHER SCIENTIFIC Y WATERS." }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO", "moved_at": null }, "buyer": { "agency": "SENASICA", "acronym": "SENASICA", "branch": "08 - AGRICULTURA Y DESARROLLO RURAL", "buying_unit": "DIRECCIÓN DE RECURSOS MATERIALES Y SERVICIOS GENERALES", "requesting_unit": null, "requesting_group": "DIRECCIÓN DE RECURSOS MATERIALES Y SERVICIOS GENERALES", "entity": "TESORERÍA DE LA FEDERACIÓN", "slug": "senasica", "unit_slug": "direccion-de-recursos-materiales-y-servicios-generales-008b00001" }, "classification": { "procedure_type": "ADJUDICACIÓN DIRECTA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "NACIONAL", "fiscal_year": 2023, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": "22", "exception_basis": "Art. 41 fr. I", "internal_control_number": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "supply_source_number": null }, "schedule": { "published_at": "2023-05-29T18:11:39.000Z", "clarification_meeting_at": null, "clarification_questions_deadline_at": null, "clarification_responses_deadline_at": null, "bid_opening_at": null, "award_at": null, "estimated_contract_at": "2023-05-12T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "locations": { "state_id": "7", "state": "CIUDAD DE MÉXICO", "bid_opening": null, "award": null, "clarification_meeting": null, "site_visit": null, "work_site": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "financial_terms": { "currency": "MXN", "advance_percentage": "0", "supplier_percentage": "10", "payment_method": "TRANSFERENCIA ELECTRÓNICA", "credit_condition": null, "payment_conditions": null, "financing_organization": null }, "evaluation": { "criterion": "BINARIO", "technical_points": null, "economic_points": null }, "guarantees": { "performance_required": true, "goods_or_services_required": false, "amount_percentage": null, "delivery_days": "10", "term_months": null, "other_insurance_required": false, "other_insurance_description": null, "performance_reduction": null }, "participation": { "method": null, "joint": false, "msme_only": false, "social_witness": false, "multi_year": false, "open_contract": false, "consolidated_purchase": false, "external_credit": false, "simultaneous_supply": false, "subcontracting": null, "emergency": false, "proposal_language": "idioma data", "no_joint_participation_justification": null }, "execution": { "site_visit_required": null, "duration_days": null, "procurement_term": "Normal", "subcontracted_work": null, "deadline_justification": null }, "lots": [ { "number": "1", "name": "PARTIDA SOLA", "description": "PARTIDA SOLA", "requirement_group_id": "1", "items": [ { "number": "1", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "APPLIED BIOSYSTEMS ARREGLO CAPILARES 50 CM SU USO EN EL ANALIZADOR GENÉTICO 3500 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4404685 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "2", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "APPLIED BIOSYSTEMS BUFFER DE SECUENCIACIÓN & TF, BDT V3.1 RR-100 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4337455 KIT 100 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "3", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "APPLIED BIOSYSTEMS CONTENEDOR DE BUFFER PARA ANODO SERIE 3500 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4393927 KIT 4 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "4", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "APPLIED BIOSYSTEMS CONTENEDOR DE BUFFER PARA CATODO SERIE 3500 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4408256 KIT 4 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "5", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "APPLIED BIOSYSTEMS MEZCLA MAESTRA EN UN SOLO PASO EN FORMATO TAQMAN PARA DETECCION DE VIRUS EN FORMATO FAST MARCA APPLIED BIOSYSTEMS CATÁLOGO 4444436 TUBO CON 10 ML", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "6", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "APPLIED BIOSYSTEMS MEZCLA MAESTRA PARA SISTEMAS TAQMAN EN FORMATO FAST ADVANCED MARCA APPLIED BIOSYSTEMS CATÁLOGO 4444963 PAQUETE 2 UNIDADES DE 5ML", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "7", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "APPLIED BIOSYSTEMS POLIMERO POP 7 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4393708 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "8", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "APPLIED BIOSYSTEMS SEPTA CON 96 POZOS SERIE 3500 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4412614 KIT 20 SEPTAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "9", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "APPLIED BIOSYSTEMS SEPTA PARA BUFFER DE CÁTODO SERIE 3500 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4410715 KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "10", "cucop_code": "25501-0084", "specific_item_code": "25501", "cucop_description": "CINTA DE CARBON", "description": "APPLIED BIOSYSTEMS FG- CUBIERTAS ADHESIVAS OPTICAS MARCA APPLIED BIOSYSTEMS CATÁLOGO 4311971 PAQUETE CON 100 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "11", "cucop_code": "25501-0071", "specific_item_code": "25501", "cucop_description": "PLACA", "description": "APPLIED BIOSYSTEMS TF- PLACAS DE 96 POZOS PARA SISTEMAS OPTICOS FAST A MARCA APPLIED BIOSYSTEMS CATÁLOGO 4366932 PAQUETE CON 200 PLACAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "12", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "INVITROGEN AGAROSA ULTRAPURA MARCA INVITROGEN CATÁLOGO 16500-500 FRASCO 500G", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "13", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "THERMO FISHER SCIENTIFIC BROMURO DE ETIDIO ULTRAPURE™, 10 MG/ML MARCA THERMO FISHER SCIENTIFIC CATÁLOGO 15585011 FRASCO CON 10 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "14", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "THERMO FISHER SCIENTIFIC DNA GEL LOADING DYE (6X) MARCA THERMO FISHER SCIENTIFIC CATÁLOGO R0611 PAQUETE 5 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "15", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "THERMO FISHER SCIENTIFIC ESTÁNDAR DE ADN DE 100 BP MARCA THERMO FISHER SCIENTIFIC CATALOGO 15628050 TUBO DE 250 µG", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "16", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "THERMO FISHER SCIENTIFIC GENERULER 100 BP DNA LADDER MARCA THERMO FISHER SCIENTIFIC CATÁLOGO SM0322  PAQUETE 5 PIEZAS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "17", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "THERMO FISHER SCIENTIFIC MEZCLA MAESTRA DREAMTAQ GREEN PCR (2X) MARCA THERMO FISHER SCIENTIFIC CATÁLOGO K1081 TUBO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "18", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "THERMO FISHER SCIENTIFIC QUBIT DSDNA BR ASSAY MARCA THERMO FISHER SCIENTIFIC CATÁLOGO Q32853 PIEZAS KIT 500 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "19", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "THERMO FISHER SCIENTIFIC QUBIT DSDNA HS ASSAY MARCA THERMO FISHER SCIENTIFIC CATÁLOGO Q32854 PIEZAS KIT 500 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "20", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "THERMO FISHER SCIENTIFIC QUBIT RNA HS ASSAY MARCA THERMO FISHER SCIENTIFIC CATÁLOGO Q32855 PIEZAS KIT 500 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "21", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "THERMO FISHER SCIENTIFIC TAMPÓN TAE (TRIS-ACETATO-EDTA) (50X) B49 MARCA THERMO FISHER SCIENTIFIC CATÁLOGO B49 FRASCO 1LT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "22", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "THERMO FISHER SCIENTIFIC TAMPÓN TRIS-HCI ULTRAPURE™ 1 M, PH 7,5 MARCA THERMO FISHER SCIENTIFIC CATÁLOGO 15567027 FRASCO 1LT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "23", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX API 20E ENTEROBACTERIAS MARCA BIOMERIEUX CATÁLOGO 20100 KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "24", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX API 20E REAGENTS MARCA BIOMERIEUX CATÁLOGO 20120 KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "25", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX API 50 CH MARCA BIOMERIEUX CATÁLOGO OT-50300 CAJA 10 TIRAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "26", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX API 50 CHB/E MEDIUM MARCA BIOMERIEUX CATÁLOGO OT-50430 CAJA C/10 APOLLETAS DE 10ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "27", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX API ESTAFILOCOCOS MARCA BIOMERIEUX CATÁLOGO 20500 CAJA 25 GALERÍAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "28", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX API LISTERIA MARCA BIOMERIEUX CATÁLOGO 10300 CAJA 25 PIEZAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "29", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX API® 20 A IDENTIFICACIÓN DE BACTERIAS ANAEROBIAS EN 24-48 HORAS MARCA BIOMERIEUX CATÁLOGO 20300 CAJA 25 GALERÍAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "30", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX API® 20 STREP MARCA BIOMERIEUX CATÁLOGO 20600 CAJA 25 GALERÍAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "31", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BIOMERIEUX BCP (PÚRPURA BROMOCRESOL) MARCA BIOMERIEUX CATÁLOGO 70510 AMPOLLETA DE 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "32", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX DENSICHEK PLUS, STANDARS KIT , CONTIENE 3 ESTANDARES, 1 BLANK MARCA BIOMERIEUX CATÁLOGO 21255 KIT", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "33", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BIOMERIEUX EHR (EHRLICH) MARCA BIOMERIEUX CATÁLOGO 70520 AMPOLLETA DE 5 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "34", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BIOMERIEUX REACTIVO NIN X 2 (NINHIDRINA) MARCA BIOMEIEUX CATÁLOGO 70491 (2) AMPOLLETA DE 5ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "35", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX STANDARD CALIBRATION DENSICHECK MARCA BIOMERIEUX CATÁLOGO 21255 TUBO CON GEL DE 2,92 MC FARLAND PARA CALIBRACIÓN DEL DENSICHECK MARCA BIOMERIEUX CATÁLOGO 21255 TUBO GEL 2,92MC", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "36", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BIOMERIEUX XYL (XILENO) MARCA BIOMERIEUX CATÁLOGO 70530 2 AMPOLLETA DE 5ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "37", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "BIOMERIEUX ZYM A X 2 MARCA BIOMERIEUX CATÁLOGO 70494 (2) AMPOLLETA DE 5ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ATCC ENTEROCOCCUS FAECALIS MARCA ATCC CATÁLOGO ATCC 29212 TUBO CON LIOFILIZADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "39", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ATCC ENTEROCOCCUS FAECALIS MARCA ATCC CATÁLOGO ATCC 33186 TUBO CON LIOFILIZADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "40", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ATCC GEOBACILLUS STEAROTHERMOPHILUS MARCA ATCC CATÁLOGO 7953 VIAL", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ATCC MELISSOCOCCUS PLUTONIUS MARCA ATCC CATÁLOGO 35311 VIAL LIOFILIZADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ATCC SALMONELLA ENTERICA SUBSP. ENTERICA (EX KAUFFMANN AND EDWARDS) LE MINOR AND POPOFF SEROVAR TYPHIMURIUM MARCA ATCC CATÁLOGO ATCC 14028 TUBO CON LIOFILIZADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "ATCC STREPTOCOCCUS PYOGENES MARCA ATCC CATÁLOGO ATCC 19615 TUBO CON LIOFILIZADO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "44", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ROCHE KIT PARA EXTRACCIÓN DE RNA MARCA ROCHE CATÁLOGO 11858882001 KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "45", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ROCHE REALTIME READY RNA VIRUS MASTER MARCA ROCHE CATÁLOGO 5619416001 KIT 10 REACCIONES", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "46", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "ROCHE TUBOS CON PERLAS DE LISADO MARCA ROCHE CATÁLOGO 3358941001 PAQUETE 100 PIEZAS", "requested_quantity": "27", "minimum_quantity": "27", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "47", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "HYGIENA BAX PCR ASSAY REAL TIME STEC PANEL 2 48 REACCIONES PCR BAX MARCA HYGIENA CATÁLOGO KIT 2009/D14642987 KIT 48 REACCIONES", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "48", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "HYGIENA BAX REAL TIME PCR ASSAY STEC SCREENING STX Y EAE MARCA HYGIENA CATÁLOGO KIT 2021/D14642964 KIT 96 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "49", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "HYGIENA BAX SYSTEM PCR ASSAY REAL TIME L. MONOCYTOGENES MARCA HYGIENA CATÁLOGO KIT 2005/D15134303 PIEZAS KIT 96 REACCIONES", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "50", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "HYGIENA BAX SYSTEM PCR ASSAY REAL TIME SALMONELLA MARCA HYGIENA CATÁLOGO KIT 2006/D14306040 PIEZAS KIT 96 REACCIONES", "requested_quantity": "23", "minimum_quantity": "23", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "51", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "HYGIENA BAX SYSTEM PCR ASSAY REAL TIME STEC PANEL 1 48 REACCIONES PCR BAX®SYSTEM MARCA HYGIENA CATÁLOGO KIT 2008/D14642970 KIT 48 REACCIONES", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "52", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "HYGIENA BAX SYSTEM REAL TIME PCR ASSAY MARCA HYGIENA CATÁLOGO KIT 2000 96 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "53", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "RANDOX KIT 19 NORTESTOSTERONE MARCA RANDOX CATÁLOGO NT2105 KIT 96 PRUEBAS", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "54", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "RANDOX KIT DE ELISA CLENBUTEROL MARCA RANDOX CATÁLOGO CB1418 KIT 96 PRUEBAS", "requested_quantity": "63", "minimum_quantity": "63", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "55", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "RANDOX KIT DE ELISA PARA DETERMINACION ETINILESTRADIOL MARCA RANDOX CATÁLOGO RLS9225 KIT 96 PRUEBAS", "requested_quantity": "14", "minimum_quantity": "14", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "56", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "RANDOX KIT DE ELISA PARA LA DETERMINACION TRENBOLONA MARCA RANDOX CATÁLOGO TB2106 KIT 96 PRUEBAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "57", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "RANDOX KIT DE ELISA PARA PHENYLBUTAZONE MARCA RANDOX CATÁLOGO PB3456 KIT 96 PRUEBAS", "requested_quantity": "9", "minimum_quantity": "9", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "58", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "RANDOX KIT DE ELISA RANDOX TETRACICLINAS MARCA RANDOX CATÁLOGO TCS10117A/B KIT 96 PRUEBAS", "requested_quantity": "9", "minimum_quantity": "9", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "59", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "RANDOX COLUMNAS INMUNOAFINIDAD PARA PROMOTORES CRECIMIENTO BOLNONA ZERANOL RACTOPAMINA Y CORTICOESTEROIS EN ORINA Y TEJIDO MARCA RANDOX CATÁLOGO GP 1821 CAJA CON 5 PIEZAS", "requested_quantity": "30", "minimum_quantity": "30", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "60", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS KIT E. COLI O103 MARCA EUROFINS ABRAXIS CATALOGO 541020, UNIDAD DE MEDIDA KIT PARA 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "61", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS KIT E. COLI O111 MARCA EUROFINS ABRAXIS CATALOGO 541030, UNIDAD DE MEDIDA KIT PARA 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "62", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS KIT E. COLI O121 MARCA EUROFINS ABRAXIS CATALOGO 541040, UNIDAD DE MEDIDA KIT PARA 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "63", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O145 MARCA EUROFINS ABRAXIS CATÁLOGO 541050 KIT 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "64", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O157:H7 MARCA EUROFINS ABRAXIS CATÁLOGO 541070 KIT 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "65", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O26 MARCA EUROFINS ABRAXIS CATÁLOGO 541000 KIT 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "66", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O45 MARCA EUROFINS ABRAXIS CATÁLOGO 541010 KIT 50 PRUEBAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "67", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS MICROCYSTIN LR MARCA EUROFINS ABRAXIS CATALOGO 300632 AMPOLLETA 1ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "68", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS MICROCYSTIN LW STANDARD, 10 µG / ML MARCA EUROFINS ABRAXIS CATALOGO 300650 AMPOLLETA 1ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "69", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS MICROCYSTIN LY STANDARD, 10 µG / ML MARCA EUROFINS ABRAXIS CATALOGO 300634 AMPOLLETA 1ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "70", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS MICROCYSTIN RR STANDARD, 10 µG / ML MARCA EUROFINS ABRAXIS CATÁLOGO 300636 AMPOLLETA 1ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "71", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROFINS ABRAXIS PERLAS DE INMUNOSEPARACION PARA E. COLI O157:H7 MARCA EUROFINS ABRAXIS CATÁLOGO 543070 FRASCO 2 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "72", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROPROXIMA KIT DE ELISA PARA LA DETERMINACION AZAPERONE-AZAPEROL MARCA EUROPROXIMA CATÁLOGO 5201AZA KIT 96 PRUEBAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "73", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROPROXIMA KIT DE ELISA PARA LA DETERMINACIÓN CARAZOLOL MARCA EUROPROXIMA CATÁLOGO 5201CARA KIT 96 PRUEBAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "74", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "EUROPROXIMA KIT DE ELISA PARA LA DETERMINACION ETINILESTRADIOL MARCA EUROPROXIMA CATÁLOGO 5081ESTR KIT 96 PRUEBAS", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "75", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R-BIOPHARM AFLASTANDARD 1000NG/ML -1X6ML MARCA R-BIOPHARM CATÁLOGO RBRP22 AMPOLLETA 6ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "76", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "R-BIOPHARM AFLATOXIN M1 STANDARD 1X6ML 1000NG/ML MARCA R-BIOPHARM CATÁLOGO TS130 AMPOLLETA 6ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "77", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "R-BIOPHARM DECOLORANTE MUESTRAS MARCA R-BIOPHARM CATÁLOGO R1699 KIT 400 PRUEBAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "78", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "R-BIOPHARM KIT DE ELISA CLENBUTEROL MARCA R-BIOPHARM CATÁLOGO R1711 PIEZAS KIT 96 PRUEBAS", "requested_quantity": "43", "minimum_quantity": "43", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "79", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "R-BIOPHARM KIT DE ELISA ESTREPTOMICINA MARCA R-BIOPHARM CATÁLOGO R3104 KIT 96 PRUEBAS", "requested_quantity": "9", "minimum_quantity": "9", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "80", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "R-BIOPHARM CARTUCHOS DE EXTRACCIÓN RIDA C18 MARCA R-BIOPHARM CATÁLOGO R-2002 CAJA CON 100 PIEZAS", "requested_quantity": "27", "minimum_quantity": "27", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "81", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "AGILENT DNA 1000 KIT MARCA AGILENT CATÁLOGO 5067-1504 KIT 300 MUESTRAS CATALOGO 5067-1504 KIT 300 MUESTRAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "82", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "AGILENT HIGH SENSITIVITY DNA MARCA AGILENT CATÁLOGO 5067-4626 KIT  110 MUESTRAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "83", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "AGILENT RNA 6000 NANO MARCA AGILENT CATÁLOGO 5067-1511 KIT 300 MUESTRAS", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "84", "cucop_code": "25501-0017", "specific_item_code": "25501", "cucop_description": "ESPITA (LLAVE)", "description": "AGILENT ANTORCHA DE MONTAJE RÁPIDO UNA PIEZAS DV ICP-OES 5100 MARCA AGILENT CATÁLOGO G8010-60228 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "85", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "AGILENT BOND ELUT  CERTIFY, 500 MG, 6 ML MARCA AGILENT CATÁLOGO 12102093 PAQUETE CON 30 PIEZAS", "requested_quantity": "100", "minimum_quantity": "100", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "86", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "AGILENT CARTUCHOS DE EXTRACCIÓN BOND ELUT-SAX 500MG/ 3ML MARCA AGILENT CATÁLOGO 12102044 CAJA CON 50 CARTUCHOS", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "87", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "AGILENT CARTUCHOS DE EXTRACCIÓN C2 500MG /3ML MARCA AGILENT CATÁLOGO 12102030 CAJA CON 50 PIEZAS", "requested_quantity": "17", "minimum_quantity": "17", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "88", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "AGILENT CARTUCHOS DE EXTRACCIÓN BOND ELUT-SCX 500MG/ 3ML MARCA AGILENT CATÁLOGO 12102040 CAJA CON 50 CARTUCHOS", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "89", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "AGILENT COLUMNA CROMATOGRÁFICA DB-1701 30M X 0.25 X 0.25 MICRAS MARCA AGILENT CATÁLOGO 122-0732 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "90", "cucop_code": "25501-0013", "specific_item_code": "25501", "cucop_description": "DEPOSITO SUSTANCIAS", "description": "AGILENT COLUMNA CROMATOGRAFICA UPLC ZORBAX RRHT ECLIPSE PAH, 95Å, 4.6 X 50 MM, 1.8 µM, PRESION MAXIMA 600 BAR MARCA AGILENT CATÁLOGO 959941-918 PIEZA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "91", "cucop_code": "25501-0013", "specific_item_code": "25501", "cucop_description": "DEPOSITO SUSTANCIAS", "description": "AGILENT COLUMNA NUT FITING MARCA AGILENT CATÁLOGO 05988-20066 PIEZA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "92", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "AGILENT CONJUNTO DE CONECTOR DE CONEXIÓN RÁPIDA INFINITYLAB CON CAPILAR DE 0,12 X 150 MM MARCA AGILENT CATÁLOGO 5067-5958 PIEZA", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "93", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "AGILENT CONJUNTO DE CONECTOR DE CONEXIÓN RÁPIDA INFINITYLAB CON CAPILAR DE 0,12 X 280 MM MARCA AGILENT CATÁLOGO 5067-5960 PIEZA", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "94", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "AGILENT DB5-MS 30 MTS LENGTH; 0,250 MM NARROWBORE; FILM 0,25 MICROMETROS, LIMITES DE TEMOPERATURA -60 A 325 °C (350 °C) MARCA AGILENT CATÁLOGO 122-5532 PIEZA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "95", "cucop_code": "25501-0083", "specific_item_code": "25501", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "description": "AGILENT FERRULA FRONTAL PARA CONECTORES DE CONEXIÓN RÁPIDA Y CONECTORES DE GIRO RÁPIDO INFINITYLAB MARCA AGILENT CATÁLOGO 5043-0924 PIEZA", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "96", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "AGILENT FILTROS DE VIDRIO ENTRADA DE DISOLVENTE MARCA AGILENT CATÁLOGO 5041-2168 PIEZA", "requested_quantity": "25", "minimum_quantity": "25", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "97", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "AGILENT FITTING-ELBOW 90-DEG 4MM-TUBING-DIA-JOIN MARCA AGILENT CATÁLOGO G8010-60328 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "98", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "AGILENT HOMOGENEIZADORES CERÁMICOS TUBOS 15ML, 100/P MARCA AGILENT CATÁLOGO 5982-9312 PAQUETE CON 100 PIEZAS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "99", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "AGILENT HOMOGENIZADORES CERAMICOS TUBOS 50 ML MARCA AGILENT CATÁLOGO 5982-9313 PAQUETE CON 100 PIEZAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "100", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "AGILENT INSERTO CÓNICO  300 µL 5.6X30MM CON PIÉ DE POLIPROPILENO MARCA AGILENT CATÁLOGO 5182-0549 PAQUETE 100 PIEZAS", "requested_quantity": "18", "minimum_quantity": "18", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "101", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "AGILENT INSERTOS DE VIDRIO DE 400 MICROLITROS MARCA AGILENT CATÁLOGO 5181-3377 PAQUETE CON 500 PIEZAS", "requested_quantity": "102", "minimum_quantity": "102", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "102", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "AGILENT JERINGA PARA AUTOMUESTREADOR DE 10 UL MARCA AGILENT CATÁLOGO 5181-3360 PAQUETE 6 PIEZAS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "103", "cucop_code": "25501-0013", "specific_item_code": "25501", "cucop_description": "DEPOSITO SUSTANCIAS", "description": "AGILENT LINER UI SPLT/LSS GOOSNCK WL 4MM 5PK V-B MARCA AGILENT CATÁLOGO 8004-0170 PAQUETE 5 PIEZAS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "104", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGILENT MS-SNOOP LÍQUIDO DETECTOR DE FUGAS MARCA AGILENT CATÁLOGO 9300-0311", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "105", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "AGILENT PTF FRITS MARCA AGILENT CATÁLOGO 01018-22707 PAQUETE 5 PIEZAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "106", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "AGILENT QUECHERS DISPERSIVE SPE 15 ML FRUITS AND VEGETABLES AOAC METHOD MARCA AGILENT CATÁLOGO 5982-5058 CAJA CON 50 PIEZAS", "requested_quantity": "35", "minimum_quantity": "35", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "107", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "AGILENT QUECHERS EXTRACTION PACKETS AOAC MARCA AGILENT CATÁLOGO 5982-6755 PAQUETE 50 PIEZAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "108", "cucop_code": "25501-0013", "specific_item_code": "25501", "cucop_description": "DEPOSITO SUSTANCIAS", "description": "AGILENT QUECHERS EXTRACTION PACKETS, AOAC MARCA AGILENT CATÁLOGO 5982-7755 CAJA CON 200 PIEZAS", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "109", "cucop_code": "25501-0013", "specific_item_code": "25501", "cucop_description": "DEPOSITO SUSTANCIAS", "description": "AGILENT QUECHERS EXTRACTION SALT PACKETS EN METHOD MARCA AGILENT CATÁLOGO 5982-6650 PAQUETE CON 50 PIEZAS", "requested_quantity": "40", "minimum_quantity": "40", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "110", "cucop_code": "25501-0083", "specific_item_code": "25501", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "description": "AGILENT SEPTAS DE PTFE/WHITE SILICONA 8,7MM MARCA AGILENT CATÁLOGO 5182-0730 PAQUETE CON 100 PIEZAS", "requested_quantity": "140", "minimum_quantity": "140", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "111", "cucop_code": "25501-0039", "specific_item_code": "25501", "cucop_description": "SONDA", "description": "AGILENT SONDA SPS4 DE 0,8 MM DE DIÁMETRO INTERNO MARCADOR VERDE INERTE MARCA AGILENT CATÁLOGO G8410-80102 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "112", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "AGILENT SPARE PRE-OPTIC WINDOWW AX,5100 ICP 1/PK MARCA AGILENT CATÁLOGO G8010-68014 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "113", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "AGILENT SPE DISPERSIVA 15ML, GRASA/PIGMENT, AOAC MARCA AGILENT CATÁLOGO 5982-5456 PAQUETE CON 50 PIEZAS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "114", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "AGILENT SYRINGE, 10 UL, PTFE,FN,BEVEL TIP MARCA AGILENT CATÁLOGO 5190-1490 PIEZA", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "115", "cucop_code": "25501-0047", "specific_item_code": "25501", "cucop_description": "TUBO ENSAYO", "description": "AGILENT TUBO DE ENSAYO, DE POLIPROPILENO 16MM MARCA AGILENT CATÁLOGO 3710051100 PAQUETE 125 PIEZAS", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "116", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "AGILENT TUBOS DE BOMBA PERISTÁLTICA, PVC BLANCO/BLANCO. 12/PAQUETE . 2 TUBOS DE PVC PUENTEADOS CON PESTAÑAS BLANCO/BLANCO PARA MUESTRAS DE AGUA MARCA AGILENT CATÁLOGO 3710034400 BOLSA 12 PIEZAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "117", "cucop_code": "25501-0013", "specific_item_code": "25501", "cucop_description": "DEPOSITO SUSTANCIAS", "description": "AGILENT ULTRA INERT INLET LINER SPLITLESS, SINGLE TAPER WOOL MARCA AGILENT CATÁLOGO 5190-3163 PAQUETE 5 PIEZAS", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "118", "cucop_code": "25501-0013", "specific_item_code": "25501", "cucop_description": "DEPOSITO SUSTANCIAS", "description": "AGILENT VF-5MS GC COLUMN, 30 M, 0.25 MM, 0.25 µM, 7 INCH CAGE MARCA AGILENT CATÁLOGO CP8944 PIEZA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "119", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "AGILENT VIAL DE VIDRIO DE 12 X 32 CON TAPA Y SEPTA ALTO RECOBRO MARCA AGILENT CATÁLOGO 8010-0414 PAQUETE CON 100 PIEZAS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "120", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT 12SPFISHFW/// 100 NMOLE DNA OLIGO /// HPLC /// CCACCTAGAGGAGCCTGTTCTAGAAC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "121", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT 12SPFISHRV /// 100 NMOLE DNA OLIGO /// HPLC /// GACGACGGCGGTATATAGGCG. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS.MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "122", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT 18SCIP /// 250 NM AFFINITY PLUS® 5´ HEX™ / 3´ IB®FQ /// HPLC /// 5HEX/CG CTA TTG GA+G +CT+G +GAA TTA CC/3IABKFQ/. ANALYTICAL RP-HPLC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI) MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "123", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT ABPV-FW /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// CAT ATT GGC GAG CCA CTA TG MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "124", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT ABPV-PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/AT AGT TAA AAC AGC TTT TCA CAC TGG /3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "125", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT ABPV-RV /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// CTA CCA GGT TCA AAG AAA ATT TC MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "126", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT BLOQUES DE GENES SINTÉTICOS MARCA IDT CATÁLOGO GBLOCKS-1 KIT", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "127", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT BQCV-PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/TT TCC ATC TTT ATC GGT ACG CCG CC/3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "128", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT CBPV-PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/TC AAG AAC GAG ACC ACC GCC AAG TTC /3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "129", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT CDLOOP-FW /// 100 NMOLE DNA OLIGO /// HPLC /// CCC AAT CCT AAC CCA ACT TAG ATA CC. TAMAÑO Y SECUENCIA VERIFICADOS POR\nESPECTROMETRÍA DE MASAS. PRESENTACIÓN: VIAL.\nMARCA: IDT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "130", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT CDLOOP-RV /// 100 NMOLE DNA OLIGO /// HPLC /// TGT GTA GGC GAG CGG TGT AA. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "131", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT CYT B-PCRV /// 100 NMOLE DNA OLIGO /// HPLC /// GGT CAA TGA ATG CGT TGT TGA T. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS.MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "132", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT CYTB-PCP /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ///56-FAM/CC ACC CAC T/ZEN/A ATA AA/3IABKFQ /// ANALYTICAL RP-HPLC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "133", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT CYTB-PLPVP /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ////56-FAM/TA ATG GCA C/ZEN/C CAA CAT T/3IABKFQ /// ANALYTICAL RP-HPLC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "134", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT CYTB-PLPVRV /// 100 NMOLE DNA OLIGO /// HPLC /// CTG GGA GGT CGA TTA GGG AGT.TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "135", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT DWV PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/CC TTG ACC AGT AGA CAC AGC ATC /3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "136", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT DWV-F /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// GCG GCT AAG ATT GTA AAT TG MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "137", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT DWV-R /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// GTG ACT AGC ATA ACC ATG ATT A MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "138", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT IAPV-FW /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// CCT ATC GCT TCA ACA TCG GAT AA. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "139", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT IAPV-RV /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// GGA CCT ATC ATC CAA CCA AAG G MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "140", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT KBV-FW /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// GCA ACT ATG TGC TAT CGT ATT ACG G. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "141", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT KBV-RV /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// TAC CGT GGG AAT ACT TCC TGG MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "142", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT ND5-PAV-FW /// 100 NMOLE DNA OLIGO /// HPLC /// TCG CAC TGT CCA TCC TCA TTC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. P MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "143", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT ND5-POL-FW /// 100 NMOLE DNA OLIGO /// HPLC /// TCG CCC TCA CAA TCC TTA CAA. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "144", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT NPI-FW /// 100 NMOLE DNA OLIGO /// HPLC /// GTT GAT MMA STA CAC CGG AG. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "145", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT NPI-RV /// 100 NMOLE DNA OLIGO /// HPLC /// AGG TCH CKT ATG AAG GAG TC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "146", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT NPI-S /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ///56-FAM/TA CAT AGG C/ZEN/A AAA CCA AAG GAG ACA C/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y\nELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "147", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT ODLOOP-FW /// 100 NMOLE DNA OLIGO /// HPLC /// ACT CCA CAA GCC CAC ATA ACA. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "148", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT ODLOOPP /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ////56-FAM/CA TAC AAG A/ZEN/A AAG CAC AAC CAC CCA CCC AC/3IABKFQ/// ANALYTICAL RP-HPLC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "149", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT ODLOOP-RV /// 100 NMOLE DNA OLIGO /// HPLC /// GGG TTT ATG AAC GCT CAT GTC C. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "150", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: 18SCI-FW: TGGTGCCAGCAGCCGC ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "151", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: 18SCI-RV: TCCAACTACGAGCTTTTTAACTGCA ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "152", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: BDLOOP-FW: AACCAAATATTACAAACACCACTAGCT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "153", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: BDLOOP-RV: CCTTGCGTAGGTAATTCATTCTG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "154", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: CITB1: CCATCCAACATCTCAGCATGAT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "155", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: CITB2: GCCCCTCAGAATGATATTTGTC ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "156", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: FC50 F AACGACTGTTAATACCGCATAATATCTG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "157", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: FC50 R CCTTACCCTACCAACTAGCTAATCCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "158", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: IHNV-FW: AGAGGGAACGAGAAAGGCA ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "159", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: IHNV-RV: TTCCAGAAGTTCGGCGAC ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "160", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: IMNV F GGACCTATCATACATAGCGTTTGCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "161", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: IMNV R AACCCATATCTATTGTCGCTGGAT ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "162", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: M153 FW: ATGACCGTCGCCCTCATCACESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "163", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: MCR1_320BP_REV: AGATCCTTGGTCTCGGCTTG  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "164", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: MCR2_700BP_REV: TCTAGCCCGACAAGCATACC  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "165", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: MCR3_900BP_REV: AATGGAGATCCCCGTTTTT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "166", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: MCR4_1100BP_REV: TTGGTCCATGACTACCAATG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "167", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: MCR5_REV:  TCATTGTGGTTGTCCTTTTCTG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "168", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: OSHV F GTCGCATCTTTGGATTTAACAA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "169", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: OSHV R ACTGGGATCCGACTGACAAC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "170", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: PMARINUS F CTTTTGYTWGAGWGTTGCGAGATG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "171", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: PMARINUS R CGAGTTTGCGAGTACCTCKAGAG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "172", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: PVNV F TGGGAACGCTATAAGTGGTTATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "173", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: PVNV R ATCGTCGAGAGGATCAGTATCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "174", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: RUM16S-FW: TGGTTGTCCAGAAGATG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "175", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: RUM16S-RV: ACTTTTAAARMTACAGTGRRATTTATTT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "176", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: SHRIMP F AAGTCTAGCCTGCCCACTG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "177", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: SHRIMP R GTCCAACCATTCATACAAGCC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "178", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: T-GLU-PCFW: GAAAAATCATCGTTGTACTTCAACTACA ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "179", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: TILV-93F: AGCCTGCCACACAGAAG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "180", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: TILV-93R: CTGCTTGAGTTGTGCTTCT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "181", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: VHS-FW: GCAGGRTGTGTGCGTC ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "182", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: VHS-RV: ATCATGGTCATTCCTGTCCC ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "183", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: YHV F CGTCCCGGCAATTGTGATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "184", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO: YHV R CCAGTGACGTTCGATGCAATA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "185", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO:  MCR3_900BP_FW: AAATAAAAATTGTTCCGCTTATG  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "186", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO:  MCR4_1100BP_FW: TCACTTTCATCACTGCGTTG  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "187", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO:  MCR5_FW: ATGCGGTTGTCTGCATTTATC  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "188", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO:M154 RV: CCATCGAGCCGTTCATGATG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "189", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO:MCR1_320BP_FW:  AGTCCGTTTGTTCTTGTGGC  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "190", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT OLIGONUCLEOTIDO:MCR2_700BP_FW:  CAAGTGTGTTGGTCGCAGTT  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "191", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT PROBE ACTIN /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/AT CGC GCC ACC CGA GAA GAA ATA T/3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "192", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT PROBE IAPV /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/TG CCA GAG CAG GAA ACG ATG ACT T/3BHQ_1/. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "193", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT PROBE KBV /// 100 NM PRIMETIME® 5´ 6-FAM 3´ BHQ-1 /// HPLC /// 56-FAM/AA GAC AGC TTT TCA CAC AGG CAG G/3BHQ_1/. MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "194", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT RUM16S-P /// 250 NM AFFINITY PLUS® 5´ 6-FAM™ / 3´ IB®FQ /// HPLC /// 56-FAM/AG TTC AGC TTT AAA RA+T +A+C+C +AA/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "195", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SBV-FW /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// AAC GTC CAC TAC ACC GAA ATG TC MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "196", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SBV-PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/TG ATG AGA GTG GAC GAA GA/3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "197", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SBV-RV /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// ACA CTG CGC GTC TAA CAT TCC MARCA: IDT PRESENTACIÓN: VIAL.", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "198", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SÍNTESIS DE JUEGO DE SONDAS PARA APLICACIONES DE QPCR MARCA IDT CATÁLOGO IDT01 KIT", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "199", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: BDLOOPP: 6FAM-ACATAACACGCCCATACACAGACCAC-3IABKFQ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "200", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: CDLOOPP: 6FAM-TGCATACACGTAATATTGTGTGGTGTTGGC-3IABKFQ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "201", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: TILV-93S FAM/CTCTACCAGCTAGTGCCCCA/-IOWA BLACK ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "202", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: VHS-S: FAM/ATGGGGGCG/ZEN/TTGAGGCTCA/3IABKFQ/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "203", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: FC50 P GTGGCCTTTGTGCTGC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "204", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: IHNV-S FAM/TCATTGCAG/ZEN/AGACGGTCCCATCGG/3IABKFQ/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "205", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: IMNV P CCACCTTTACTTTCAATACTACATCATCCCCGG ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "206", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: OSHV P TGCCCCTGTCATCTTGAGGTATAGACAATC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "207", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: PVNV P TTACGTCCCAGCGGTGCCAAATA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "208", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: SHRIMP P AGACTAATGATTATGCTACCTTCGCACGGT ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: CY5/TAO/3’ IB RQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "209", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "IDT SONDA: YHV P CCATCAAAGCTCTCAACGCCGTCA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "210", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROMEGA AGUA LIBRE DE NUCLEASAS MARCA PROMEGA CATÁLOGO P1193 FRASCO 50ML", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "211", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PROMEGA CÉLULAS COMPETENTES JM109 MARCA PROMEGA CATÁLOGO L2005 FRASCO CON 1ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "212", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PROMEGA EDTA 0.5 M MARCA PROMEGA CATÁLOGO V4231 FRASCO 100 ML", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "213", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PROMEGA GO TAQ LONG PCR MASTER MIX MARCA PROMEGA CATÁLOGO M4021 KIT 100 REACCIONES", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "214", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PROMEGA PGEM T EASY VECTOR MARCA PROMEGA CATÁLOGO A1380 KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "215", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PROMEGA SISTEMA COMERCIAL PARA LA PURIFICACIÓN A PARTIR DE SANGRE MARCA PROMEGA CATÁLOGO A5081 KIT", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "216", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PROMEGA SISTEMA DE PURIFICACIÓN DE ADN WIZARD MARCA PROMEGA CATÁLOGO A1125 KIT PARA 500 REACCIONES", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "217", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "PROMEGA SOLUCIÓN DE PROTEINASA K MARCA PROMEGA CATÁLOGO A5051 FRASCO CON 23 ML", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "218", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "PROMEGA SOLUCIÓN MAESTRA PARA PCR 2X CONTIENE TODOS LOS REACTIVOS PARA LA REACCIÓN EXCEPTO INICIADORES Y ADN BLANCO PARA 1000 REACCIONES (PCR MASTER MIX) MARCA PROMEGA CATÁLOGO M7505 FRASCO CON 25 ML", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "219", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "PROMEGA COLLECTION TUBES MARCA PROMEGA CATÁLOGO A130B PAQUETE CON 250 PIEZAS", "requested_quantity": "25", "minimum_quantity": "25", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "220", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PROMEGA MINICOLUMNS WIZARD SV GEL AND PCR CLEAN-UP SYSTEM MARCA PROMEGA A9281 KIT DE 50 REACCIONES", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "221", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PROMEGA MINICOLUMNS WIZARD SV GEL AND PCR CLEAN-UP SYSTEM MARCA PROMEGA CATÁLOGO A129B KIT 250 REACCIONES", "requested_quantity": "56", "minimum_quantity": "56", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "222", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "PROMEGA MINICOLUMNS WIZARD Y COLLECTION TUBES MARCA PROMEGA CATÁLOGO A1460 KIT", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "223", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "WATERS PIC A REAGENT MARCA WATERS CATÁLOGO WAT085101 PAQUETE 5 PIEZAS", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "224", "cucop_code": "25501-0013", "specific_item_code": "25501", "cucop_description": "DEPOSITO SUSTANCIAS", "description": "WATERS ACQUITY UPLC BEH C18 COLUMN, 130Å, 1.7 µM, 2.1 MM X 100 MM MARCA WATERS CATÁLOGO 186002352 PIEZA", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "225", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "WATERS ACQUITY UPLC BEH C18 VANGUARD PRE-COLUMN 130Å 1.7 µM 2.1 MM X 5 MM MARCA WATERS CATÁLOGO 186003975 PAQUETE 3 PIEZAS", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "226", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "WATERS ACQUITY UPLC BEH PHENYL 1.7 µM 2.1 MM X 100 MM COLUMN MARCA WATERS CATÁLOGO 186002885 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "227", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "WATERS ACQUITY UPLC BEH SHIELD RP18 VANGUARD PRE-COLUMN 130Å 1.7 µM 2.1 MM X 5 MM MARCA WATERS CATÁLOGO 186003977 PAQUETE 3 PIEZAS", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "228", "cucop_code": "25501-0013", "specific_item_code": "25501", "cucop_description": "DEPOSITO SUSTANCIAS", "description": "WATERS ACQUITY UPLC HSS PFP COLUMN, 100Å, 1.8 µM, 2.1 MM X 100 MM, 1/PKG MARCA WATERS CATÁLOGO 1860005967 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "229", "cucop_code": "25501-0061", "specific_item_code": "25501", "cucop_description": "ACRODISCOS", "description": "WATERS ACRODISCOS PTFE 0,45µM X 4MM MARCA WATERS CATÁLOGO WAT200508 PAQUETE 250PZ", "requested_quantity": "14", "minimum_quantity": "14", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "230", "cucop_code": "25501-0061", "specific_item_code": "25501", "cucop_description": "ACRODISCOS", "description": "WATERS ACRODISCOS PTFE DE 13MM, 0.2µM.CON PUNTA MINISPIKE MARCA WATERS CATÁLOGO WAT200824 PAQUETE 1000 PIEZAS", "requested_quantity": "11", "minimum_quantity": "11", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "231", "cucop_code": "25501-0061", "specific_item_code": "25501", "cucop_description": "ACRODISCOS", "description": "WATERS ACRODISCOS PVDF DE 13 MM, 0.2 µM MARCA WATERS CATÁLOGO WAT200806 PAQUETE 100 PIEZAS", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "232", "cucop_code": "25501-0061", "specific_item_code": "25501", "cucop_description": "ACRODISCOS", "description": "WATERS ACTIVE PREHEATER (APH), SS, .003 IN ID X 12.5 IN, WITH GASKET - PLUS MARCA WATERS CATÁLOGO 205001757 PIEZA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "233", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "WATERS ASSY NEEDLE SAMPLE MARCA WATERS CATÁLOGO 700002644 PIEZA", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "234", "cucop_code": "25501-0095", "specific_item_code": "25501", "cucop_description": "PUNTAS PARA MICROPIPETA", "description": "WATERS BLUE 12 X 32MM SCREW NECK CAP AND PRESLIT PTFE/SILICONE SEPTUM MARCA WATERS CATÁLOGO 186000305 CAJA 100 PIEZAS", "requested_quantity": "75", "minimum_quantity": "75", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "235", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "WATERS CARTUCHOS DE ALUMINA B SEP-PAK CLASSIC MARCA WATERS CATÁLOGO WAT051820 CAJA 50 PIEZAS", "requested_quantity": "29", "minimum_quantity": "29", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "236", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "WATERS CARTUCHOS DE EXTRACCIÓN DE FASE SÓLIDA OASIS HLB 6 CC (200 MG) MARCA WATERS CATÁLOGO WAT106202 CAJA 30 PIEZAS", "requested_quantity": "130", "minimum_quantity": "130", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "237", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "WATERS CARTUCHOS DE EXTRACCIÓN DE SILICA SEP-PAK VAC 6 CC (1G) MARCA WATERS CATÁLOGO WAT036910 PAQUETE 30 PIEZAS", "requested_quantity": "80", "minimum_quantity": "80", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "238", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "WATERS CARTUCHOS DE EXTRACCION OASIS MCX 3 CC (60MG) MARCA WATERS CATÁLOGO 186000253 CAJA 100 PIEZAS", "requested_quantity": "12", "minimum_quantity": "12", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "239", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "WATERS COLUMNA ACQUITY UPLC BEH HILIC COLUMN, 130Å, 1.7 µM, 2.1 MM X 50 MM, 1/PKG MARCA WATERS CATÁLOGO 186003460 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "240", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "WATERS COLUMNA ATLANTIS HILIC SILICA 3 µM 2.1X50 MM MARCA WATERS CATÁLOGO 186002011 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "241", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "WATERS COLUMNA BEH C18 1.7µM 2.1X50MM MARCA WATERS CATÁLOGO 186002350 PIEZA", "requested_quantity": "17", "minimum_quantity": "17", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "242", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "WATERS COLUMNA CROMATOGRAFICA WATERS PAH C18, 120 Å, 3 µM, 4.6 MM X 50 MM, 1/PK MARCA WATERS CATÁLOGO 186001260 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "243", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "WATERS COLUMNA HSST3 1.8µM 2.1X100MM MARCA WATERS CATÁLOGO 186003539 PIEZA", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "244", "cucop_code": "25501-0092", "specific_item_code": "25501", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "description": "WATERS CONE GAS NOZZLE (# 700004216)/XEVO MARCA WATERS CATÁLOGO 700004216 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "245", "cucop_code": "25501-0013", "specific_item_code": "25501", "cucop_description": "DEPOSITO SUSTANCIAS", "description": "WATERS DISQUE QUECHERS, 150 MG MGSO4 & 50 MG PSA, 2 ML TUBE MARCA WATERS CATÁLOGO 186004572 CAJA 100 PIEZAS", "requested_quantity": "21", "minimum_quantity": "21", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "246", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "WATERS FILTROS PARA ENTRADA DE SOLVENTE SISTEMA MARCA WATERS CATÁLOGO WAT025531 PIEZA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "247", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "WATERS HANDLE CONE GAS NOZZLE (XEVO SUJETADOR) MARCA WATERS CATÁLOGO 700010292 PIEZA", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "248", "cucop_code": "25501-0105", "specific_item_code": "25501", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "description": "WATERS JERINGA PEEK DE 30 µL MARCA WATERS CATÁLOGO 700002644 PIEZA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "249", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "WATERS LCMS CERTIFIED AMBER GLASS 12 X 32MM SCREW NECK VIAL, WITH CAP AND PRESLIT PTFE/SILICONE SEPTA, 2 ML MARCA WATERS CATÁLOGO 600000669CV PAQUETE 100 PIEZAS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "250", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "WATERS LCMS CERTIFIED CLEAR GLASS 12 X 32MM SCREW NECK VIAL, WITH CAP AND PRESLIT PTFE/SILICONE SEPTA, 2 ML MARCA WATERS CATÁLOGO 600000668CV PAQUETE 100 PIEZAS", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "251", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "WATERS PRE-COLUMNA HSST3 1.8µM 2.1X5MM MARCA WATERS CATÁLOGO 186003976 PAQUETE 3 PIEZAS", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "252", "cucop_code": "25501-0083", "specific_item_code": "25501", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "description": "WATERS SEPTAS PREHORADADAS PTFE DE SILICÓN DE PS 8 MILÍMETROS MARCA WATERS CATÁLOGO WAT058876 PAQUETE 100 PIEZAS", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "253", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "WATERS VIAL DE VIDRIO DE 2ML CON TAPON DE ROSCA MARCA WATERS CATÁLOGO 186000307C RACK 100 PIEZAS", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "254", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "WATERS VIAL HOLDER, 48-WELL, 2ML VIAL [405003743] MARCA WATERS CATÁLOGO 700011047 PIEZA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] } ], "budget_items": [ { "code": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "code": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "awards": [ { "id": "C-2023-00045474", "internal_reference": "057-2023-001", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "normalized_name": "AGILENT TECHNOLOGIES MEXICO", "rfc_type": null, "slug": "agilent-technologies-mexico" }, "contract_period": { "published_at": "2023-06-07T23:39:24.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "1983008.16", "tax": "317281.29", "total": "2300289.45", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0017", "description": "AGILENT ANTORCHA DE MONTAJE RÁPIDO UNA PIEZAS DV ICP-OES 5100 MARCA AGILENT CATÁLOGO G8010-60228 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "22258.64", "subtotal": "44517.28", "tax": "7122.76", "other_taxes": null, "total": "51640.04", "cucop_description": "ESPITA (LLAVE)", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "AGILENT BOND ELUT  CERTIFY, 500 MG, 6 ML MARCA AGILENT CATÁLOGO 12102093 PAQUETE CON 30 PIEZAS", "unit": "PIEZA", "requested_quantity": "100", "awarded_quantity": null, "unit_price": "3544.13", "subtotal": "354413", "tax": "56706.08", "other_taxes": null, "total": "411119.08", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "AGILENT CARTUCHOS DE EXTRACCIÓN BOND ELUT-SAX 500MG/ 3ML MARCA AGILENT CATÁLOGO 12102044 CAJA CON 50 CARTUCHOS", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "5475.59", "subtotal": "82133.85", "tax": "13141.42", "other_taxes": null, "total": "95275.27", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "AGILENT CARTUCHOS DE EXTRACCIÓN C2 500MG /3ML MARCA AGILENT CATÁLOGO 12102030 CAJA CON 50 PIEZAS", "unit": "PIEZA", "requested_quantity": "17", "awarded_quantity": null, "unit_price": "3937.92", "subtotal": "66944.64", "tax": "10711.14", "other_taxes": null, "total": "77655.78", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "AGILENT CARTUCHOS DE EXTRACCIÓN BOND ELUT-SCX 500MG/ 3ML MARCA AGILENT CATÁLOGO 12102040 CAJA CON 50 CARTUCHOS", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "5475.59", "subtotal": "82133.85", "tax": "13141.42", "other_taxes": null, "total": "95275.27", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "AGILENT COLUMNA CROMATOGRÁFICA DB-1701 30M X 0.25 X 0.25 MICRAS MARCA AGILENT CATÁLOGO 122-0732 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14739.08", "subtotal": "14739.08", "tax": "2358.25", "other_taxes": null, "total": "17097.33", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0013", "description": "AGILENT COLUMNA CROMATOGRAFICA UPLC ZORBAX RRHT ECLIPSE PAH, 95Å, 4.6 X 50 MM, 1.8 µM, PRESION MAXIMA 600 BAR MARCA AGILENT CATÁLOGO 959941-918 PIEZA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "13970.25", "subtotal": "41910.75", "tax": "6705.72", "other_taxes": null, "total": "48616.47", "cucop_description": "DEPOSITO SUSTANCIAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0013", "description": "AGILENT COLUMNA NUT FITING MARCA AGILENT CATÁLOGO 05988-20066 PIEZA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "453.61", "subtotal": "1360.83", "tax": "217.73", "other_taxes": null, "total": "1578.56", "cucop_description": "DEPOSITO SUSTANCIAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "AGILENT CONJUNTO DE CONECTOR DE CONEXIÓN RÁPIDA INFINITYLAB CON CAPILAR DE 0,12 X 150 MM MARCA AGILENT CATÁLOGO 5067-5958 PIEZA", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "7294.53", "subtotal": "72945.3", "tax": "11671.25", "other_taxes": null, "total": "84616.55", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "AGILENT CONJUNTO DE CONECTOR DE CONEXIÓN RÁPIDA INFINITYLAB CON CAPILAR DE 0,12 X 280 MM MARCA AGILENT CATÁLOGO 5067-5960 PIEZA", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "7294.53", "subtotal": "72945.3", "tax": "11671.25", "other_taxes": null, "total": "84616.55", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "AGILENT DB5-MS 30 MTS LENGTH; 0,250 MM NARROWBORE; FILM 0,25 MICROMETROS, LIMITES DE TEMOPERATURA -60 A 325 °C (350 °C) MARCA AGILENT CATÁLOGO 122-5532 PIEZA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "16014.22", "subtotal": "48042.66", "tax": "7686.83", "other_taxes": null, "total": "55729.49", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0083", "description": "AGILENT FERRULA FRONTAL PARA CONECTORES DE CONEXIÓN RÁPIDA Y CONECTORES DE GIRO RÁPIDO INFINITYLAB MARCA AGILENT CATÁLOGO 5043-0924 PIEZA", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "119.08", "subtotal": "1190.8", "tax": "190.53", "other_taxes": null, "total": "1381.33", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "AGILENT FILTROS DE VIDRIO ENTRADA DE DISOLVENTE MARCA AGILENT CATÁLOGO 5041-2168 PIEZA", "unit": "PIEZA", "requested_quantity": "25", "awarded_quantity": null, "unit_price": "1374.52", "subtotal": "34363", "tax": "5498.08", "other_taxes": null, "total": "39861.08", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "AGILENT FITTING-ELBOW 90-DEG 4MM-TUBING-DIA-JOIN MARCA AGILENT CATÁLOGO G8010-60328 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6046.96", "subtotal": "6046.96", "tax": "967.51", "other_taxes": null, "total": "7014.47", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0048", "description": "AGILENT HOMOGENEIZADORES CERÁMICOS TUBOS 15ML, 100/P MARCA AGILENT CATÁLOGO 5982-9312 PAQUETE CON 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1248.13", "subtotal": "6240.65", "tax": "998.5", "other_taxes": null, "total": "7239.15", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0048", "description": "AGILENT HOMOGENIZADORES CERAMICOS TUBOS 50 ML MARCA AGILENT CATÁLOGO 5982-9313 PAQUETE CON 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1248.13", "subtotal": "12481.3", "tax": "1997.01", "other_taxes": null, "total": "14478.31", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "AGILENT INSERTO CÓNICO  300 µL 5.6X30MM CON PIÉ DE POLIPROPILENO MARCA AGILENT CATÁLOGO 5182-0549 PAQUETE 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "18", "awarded_quantity": null, "unit_price": "658.01", "subtotal": "11844.18", "tax": "1895.07", "other_taxes": null, "total": "13739.25", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "AGILENT INSERTOS DE VIDRIO DE 400 MICROLITROS MARCA AGILENT CATÁLOGO 5181-3377 PAQUETE CON 500 PIEZAS", "unit": "PIEZA", "requested_quantity": "102", "awarded_quantity": null, "unit_price": "1764.19", "subtotal": "179947.38", "tax": "28791.58", "other_taxes": null, "total": "208738.96", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0105", "description": "AGILENT JERINGA PARA AUTOMUESTREADOR DE 10 UL MARCA AGILENT CATÁLOGO 5181-3360 PAQUETE 6 PIEZAS", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "6900.74", "subtotal": "41404.44", "tax": "6624.71", "other_taxes": null, "total": "48029.15", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0013", "description": "AGILENT LINER UI SPLT/LSS GOOSNCK WL 4MM 5PK V-B MARCA AGILENT CATÁLOGO 8004-0170 PAQUETE 5 PIEZAS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "4106.69", "subtotal": "20533.45", "tax": "3285.35", "other_taxes": null, "total": "23818.8", "cucop_description": "DEPOSITO SUSTANCIAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "AGILENT MS-SNOOP LÍQUIDO DETECTOR DE FUGAS MARCA AGILENT CATÁLOGO 9300-0311", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "428.3", "subtotal": "428.3", "tax": "68.53", "other_taxes": null, "total": "496.83", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0082", "description": "AGILENT PTF FRITS MARCA AGILENT CATÁLOGO 01018-22707 PAQUETE 5 PIEZAS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "925.6", "subtotal": "9256", "tax": "1480.96", "other_taxes": null, "total": "10736.96", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "AGILENT QUECHERS DISPERSIVE SPE 15 ML FRUITS AND VEGETABLES AOAC METHOD MARCA AGILENT CATÁLOGO 5982-5058 CAJA CON 50 PIEZAS", "unit": "PIEZA", "requested_quantity": "35", "awarded_quantity": null, "unit_price": "3412.87", "subtotal": "119450.45", "tax": "19112.07", "other_taxes": null, "total": "138562.52", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "AGILENT QUECHERS EXTRACTION PACKETS AOAC MARCA AGILENT CATÁLOGO 5982-6755 PAQUETE 50 PIEZAS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "4050.43", "subtotal": "12151.29", "tax": "1944.21", "other_taxes": null, "total": "14095.5", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0013", "description": "AGILENT QUECHERS EXTRACTION PACKETS, AOAC MARCA AGILENT CATÁLOGO 5982-7755 CAJA CON 200 PIEZAS", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "15526.66", "subtotal": "232899.9", "tax": "37263.98", "other_taxes": null, "total": "270163.88", "cucop_description": "DEPOSITO SUSTANCIAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0013", "description": "AGILENT QUECHERS EXTRACTION SALT PACKETS EN METHOD MARCA AGILENT CATÁLOGO 5982-6650 PAQUETE CON 50 PIEZAS", "unit": "PIEZA", "requested_quantity": "40", "awarded_quantity": null, "unit_price": "4050.43", "subtotal": "162017.2", "tax": "25922.75", "other_taxes": null, "total": "187939.95", "cucop_description": "DEPOSITO SUSTANCIAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0083", "description": "AGILENT SEPTAS DE PTFE/WHITE SILICONA 8,7MM MARCA AGILENT CATÁLOGO 5182-0730 PAQUETE CON 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "140", "awarded_quantity": null, "unit_price": "529.37", "subtotal": "74111.8", "tax": "11857.89", "other_taxes": null, "total": "85969.69", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0039", "description": "AGILENT SONDA SPS4 DE 0,8 MM DE DIÁMETRO INTERNO MARCADOR VERDE INERTE MARCA AGILENT CATÁLOGO G8410-80102 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9563.53", "subtotal": "9563.53", "tax": "1530.16", "other_taxes": null, "total": "11093.69", "cucop_description": "SONDA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "AGILENT SPARE PRE-OPTIC WINDOWW AX,5100 ICP 1/PK MARCA AGILENT CATÁLOGO G8010-68014 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3300.35", "subtotal": "6600.7", "tax": "1056.11", "other_taxes": null, "total": "7656.81", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "AGILENT SPE DISPERSIVA 15ML, GRASA/PIGMENT, AOAC MARCA AGILENT CATÁLOGO 5982-5456 PAQUETE CON 50 PIEZAS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "7594.56", "subtotal": "37972.8", "tax": "6075.65", "other_taxes": null, "total": "44048.45", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "AGILENT SYRINGE, 10 UL, PTFE,FN,BEVEL TIP MARCA AGILENT CATÁLOGO 5190-1490 PIEZA", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1191.88", "subtotal": "11918.8", "tax": "1907.01", "other_taxes": null, "total": "13825.81", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0047", "description": "AGILENT TUBO DE ENSAYO, DE POLIPROPILENO 16MM MARCA AGILENT CATÁLOGO 3710051100 PAQUETE 125 PIEZAS", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "871.03", "subtotal": "2613.09", "tax": "418.09", "other_taxes": null, "total": "3031.18", "cucop_description": "TUBO ENSAYO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0048", "description": "AGILENT TUBOS DE BOMBA PERISTÁLTICA, PVC BLANCO/BLANCO. 12/PAQUETE . 2 TUBOS DE PVC PUENTEADOS CON PESTAÑAS BLANCO/BLANCO PARA MUESTRAS DE AGUA MARCA AGILENT CATÁLOGO 3710034400 BOLSA 12 PIEZAS", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1278.14", "subtotal": "12781.4", "tax": "2045.02", "other_taxes": null, "total": "14826.42", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0013", "description": "AGILENT ULTRA INERT INLET LINER SPLITLESS, SINGLE TAPER WOOL MARCA AGILENT CATÁLOGO 5190-3163 PAQUETE 5 PIEZAS", "unit": "PIEZA", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "3750.4", "subtotal": "26252.8", "tax": "4200.45", "other_taxes": null, "total": "30453.25", "cucop_description": "DEPOSITO SUSTANCIAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0013", "description": "AGILENT VF-5MS GC COLUMN, 30 M, 0.25 MM, 0.25 µM, 7 INCH CAGE MARCA AGILENT CATÁLOGO CP8944 PIEZA", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "16014.22", "subtotal": "64056.88", "tax": "10249.1", "other_taxes": null, "total": "74305.98", "cucop_description": "DEPOSITO SUSTANCIAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "AGILENT VIAL DE VIDRIO DE 12 X 32 CON TAPA Y SEPTA ALTO RECOBRO MARCA AGILENT CATÁLOGO 8010-0414 PAQUETE CON 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1198.63", "subtotal": "4794.52", "tax": "767.12", "other_taxes": null, "total": "5561.64", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2023-00045483", "internal_reference": "057-2023-002", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "normalized_name": "APPLIED BIOSYSTEMS DE MEXICO", "rfc_type": null, "slug": "applied-biosystems-de-mexico" }, "contract_period": { "published_at": "2023-06-13T18:08:33.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "735001.1", "tax": "117600.18", "total": "852601.28", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "APPLIED BIOSYSTEMS ARREGLO CAPILARES 50 CM SU USO EN EL ANALIZADOR GENÉTICO 3500 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4404685 PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "30851.73", "subtotal": "30851.73", "tax": "4936.28", "other_taxes": null, "total": "35788.01", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "APPLIED BIOSYSTEMS BUFFER DE SECUENCIACIÓN & TF, BDT V3.1 RR-100 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4337455 KIT 100 REACCIONES", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "23701.24", "subtotal": "23701.24", "tax": "3792.2", "other_taxes": null, "total": "27493.44", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "APPLIED BIOSYSTEMS CONTENEDOR DE BUFFER PARA ANODO SERIE 3500 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4393927 KIT 4 PIEZAS", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2610.78", "subtotal": "5221.56", "tax": "835.45", "other_taxes": null, "total": "6057.01", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "APPLIED BIOSYSTEMS CONTENEDOR DE BUFFER PARA CATODO SERIE 3500 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4408256 KIT 4 PIEZAS", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3470.42", "subtotal": "6940.84", "tax": "1110.53", "other_taxes": null, "total": "8051.37", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "APPLIED BIOSYSTEMS MEZCLA MAESTRA EN UN SOLO PASO EN FORMATO TAQMAN PARA DETECCION DE VIRUS EN FORMATO FAST MARCA APPLIED BIOSYSTEMS CATÁLOGO 4444436 TUBO CON 10 ML", "unit": "LITRO", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "70115.6", "subtotal": "420693.6", "tax": "67310.98", "other_taxes": null, "total": "488004.58", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "APPLIED BIOSYSTEMS MEZCLA MAESTRA PARA SISTEMAS TAQMAN EN FORMATO FAST ADVANCED MARCA APPLIED BIOSYSTEMS CATÁLOGO 4444963 PAQUETE 2 UNIDADES DE 5ML", "unit": "LITRO", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "14615.94", "subtotal": "73079.7", "tax": "11692.75", "other_taxes": null, "total": "84772.45", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "APPLIED BIOSYSTEMS POLIMERO POP 7 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4393708 PIEZA", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4521.1", "subtotal": "9042.2", "tax": "1446.75", "other_taxes": null, "total": "10488.95", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "APPLIED BIOSYSTEMS SEPTA CON 96 POZOS SERIE 3500 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4412614 KIT 20 SEPTAS", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6295.5", "subtotal": "12591", "tax": "2014.56", "other_taxes": null, "total": "14605.56", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "APPLIED BIOSYSTEMS SEPTA PARA BUFFER DE CÁTODO SERIE 3500 MARCA APPLIED BIOSYSTEMS CATÁLOGO 4410715 KIT", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6295.5", "subtotal": "12591", "tax": "2014.56", "other_taxes": null, "total": "14605.56", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0084", "description": "APPLIED BIOSYSTEMS FG- CUBIERTAS ADHESIVAS OPTICAS MARCA APPLIED BIOSYSTEMS CATÁLOGO 4311971 PAQUETE CON 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3504.71", "subtotal": "7009.42", "tax": "1121.51", "other_taxes": null, "total": "8130.93", "cucop_description": "CINTA DE CARBON", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0071", "description": "APPLIED BIOSYSTEMS TF- PLACAS DE 96 POZOS PARA SISTEMAS OPTICOS FAST A MARCA APPLIED BIOSYSTEMS CATÁLOGO 4366932 PAQUETE CON 200 PLACAS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "12279.46", "subtotal": "24558.92", "tax": "3929.43", "other_taxes": null, "total": "28488.35", "cucop_description": "PLACA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "INVITROGEN AGAROSA ULTRAPURA MARCA INVITROGEN CATÁLOGO 16500-500 FRASCO 500G", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "11582.19", "subtotal": "46328.76", "tax": "7412.6", "other_taxes": null, "total": "53741.36", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "THERMO FISHER SCIENTIFIC BROMURO DE ETIDIO ULTRAPURE™, 10 MG/ML MARCA THERMO FISHER SCIENTIFIC CATÁLOGO 15585011 FRASCO CON 10 ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1600.17", "subtotal": "1600.17", "tax": "256.03", "other_taxes": null, "total": "1856.2", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "THERMO FISHER SCIENTIFIC DNA GEL LOADING DYE (6X) MARCA THERMO FISHER SCIENTIFIC CATÁLOGO R0611 PAQUETE 5 PIEZAS", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "772.25", "subtotal": "1544.5", "tax": "247.12", "other_taxes": null, "total": "1791.62", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "THERMO FISHER SCIENTIFIC ESTÁNDAR DE ADN DE 100 BP MARCA THERMO FISHER SCIENTIFIC CATALOGO 15628050 TUBO DE 250 µG", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5470.26", "subtotal": "5470.26", "tax": "875.24", "other_taxes": null, "total": "6345.5", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "THERMO FISHER SCIENTIFIC GENERULER 100 BP DNA LADDER MARCA THERMO FISHER SCIENTIFIC CATÁLOGO SM0322  PAQUETE 5 PIEZAS", "unit": "LITRO", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "5117.34", "subtotal": "30704.04", "tax": "4912.65", "other_taxes": null, "total": "35616.69", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "THERMO FISHER SCIENTIFIC MEZCLA MAESTRA DREAMTAQ GREEN PCR (2X) MARCA THERMO FISHER SCIENTIFIC CATÁLOGO K1081 TUBO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2117.52", "subtotal": "2117.52", "tax": "338.8", "other_taxes": null, "total": "2456.32", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "THERMO FISHER SCIENTIFIC QUBIT DSDNA BR ASSAY MARCA THERMO FISHER SCIENTIFIC CATÁLOGO Q32853 PIEZAS KIT 500 REACCIONES", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6047.77", "subtotal": "6047.77", "tax": "967.64", "other_taxes": null, "total": "7015.41", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "THERMO FISHER SCIENTIFIC QUBIT DSDNA HS ASSAY MARCA THERMO FISHER SCIENTIFIC CATÁLOGO Q32854 PIEZAS KIT 500 REACCIONES", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6063.81", "subtotal": "6063.81", "tax": "970.21", "other_taxes": null, "total": "7034.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "THERMO FISHER SCIENTIFIC QUBIT RNA HS ASSAY MARCA THERMO FISHER SCIENTIFIC CATÁLOGO Q32855 PIEZAS KIT 500 REACCIONES", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5967.56", "subtotal": "5967.56", "tax": "954.81", "other_taxes": null, "total": "6922.37", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "THERMO FISHER SCIENTIFIC TAMPÓN TAE (TRIS-ACETATO-EDTA) (50X) B49 MARCA THERMO FISHER SCIENTIFIC CATÁLOGO B49 FRASCO 1LT", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1812.73", "subtotal": "1812.73", "tax": "290.04", "other_taxes": null, "total": "2102.77", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "THERMO FISHER SCIENTIFIC TAMPÓN TRIS-HCI ULTRAPURE™ 1 M, PH 7,5 MARCA THERMO FISHER SCIENTIFIC CATÁLOGO 15567027 FRASCO 1LT", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1062.77", "subtotal": "1062.77", "tax": "170.04", "other_taxes": null, "total": "1232.81", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2023-00045484", "internal_reference": "057-2023-003", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "BIOMERIEUX MEXICO SA DE CV", "normalized_name": "BIOMERIEUX MEXICO", "rfc_type": null, "slug": "biomerieux-mexico" }, "contract_period": { "published_at": "2023-06-07T23:46:02.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "65557", "tax": "10489.12", "total": "76046.12", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX API 20E ENTEROBACTERIAS MARCA BIOMERIEUX CATÁLOGO 20100 KIT", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4079", "subtotal": "4079", "tax": "652.64", "other_taxes": null, "total": "4731.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX API 20E REAGENTS MARCA BIOMERIEUX CATÁLOGO 20120 KIT", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2355", "subtotal": "2355", "tax": "376.8", "other_taxes": null, "total": "2731.8", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX API 50 CH MARCA BIOMERIEUX CATÁLOGO OT-50300 CAJA 10 TIRAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9539", "subtotal": "9539", "tax": "1526.24", "other_taxes": null, "total": "11065.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX API 50 CHB/E MEDIUM MARCA BIOMERIEUX CATÁLOGO OT-50430 CAJA C/10 APOLLETAS DE 10ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2102", "subtotal": "2102", "tax": "336.32", "other_taxes": null, "total": "2438.32", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX API ESTAFILOCOCOS MARCA BIOMERIEUX CATÁLOGO 20500 CAJA 25 GALERÍAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7054", "subtotal": "7054", "tax": "1128.64", "other_taxes": null, "total": "8182.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX API LISTERIA MARCA BIOMERIEUX CATÁLOGO 10300 CAJA 25 PIEZAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5938", "subtotal": "5938", "tax": "950.08", "other_taxes": null, "total": "6888.08", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX API® 20 A IDENTIFICACIÓN DE BACTERIAS ANAEROBIAS EN 24-48 HORAS MARCA BIOMERIEUX CATÁLOGO 20300 CAJA 25 GALERÍAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7966", "subtotal": "7966", "tax": "1274.56", "other_taxes": null, "total": "9240.56", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX API® 20 STREP MARCA BIOMERIEUX CATÁLOGO 20600 CAJA 25 GALERÍAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7406", "subtotal": "7406", "tax": "1184.96", "other_taxes": null, "total": "8590.96", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BIOMERIEUX BCP (PÚRPURA BROMOCRESOL) MARCA BIOMERIEUX CATÁLOGO 70510 AMPOLLETA DE 5 ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "427", "subtotal": "427", "tax": "68.32", "other_taxes": null, "total": "495.32", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX DENSICHEK PLUS, STANDARS KIT , CONTIENE 3 ESTANDARES, 1 BLANK MARCA BIOMERIEUX CATÁLOGO 21255 KIT", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5172", "subtotal": "10344", "tax": "1655.04", "other_taxes": null, "total": "11999.04", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BIOMERIEUX EHR (EHRLICH) MARCA BIOMERIEUX CATÁLOGO 70520 AMPOLLETA DE 5 ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "760", "subtotal": "760", "tax": "121.6", "other_taxes": null, "total": "881.6", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BIOMERIEUX REACTIVO NIN X 2 (NINHIDRINA) MARCA BIOMEIEUX CATÁLOGO 70491 (2) AMPOLLETA DE 5ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "754", "subtotal": "754", "tax": "120.64", "other_taxes": null, "total": "874.64", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX STANDARD CALIBRATION DENSICHECK MARCA BIOMERIEUX CATÁLOGO 21255 TUBO CON GEL DE 2,92 MC FARLAND PARA CALIBRACIÓN DEL DENSICHECK MARCA BIOMERIEUX CATÁLOGO 21255 TUBO GEL 2,92MC", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5172", "subtotal": "5172", "tax": "827.52", "other_taxes": null, "total": "5999.52", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BIOMERIEUX XYL (XILENO) MARCA BIOMERIEUX CATÁLOGO 70530 2 AMPOLLETA DE 5ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "735", "subtotal": "735", "tax": "117.6", "other_taxes": null, "total": "852.6", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "BIOMERIEUX ZYM A X 2 MARCA BIOMERIEUX CATÁLOGO 70494 (2) AMPOLLETA DE 5ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "926", "subtotal": "926", "tax": "148.16", "other_taxes": null, "total": "1074.16", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2023-00045488", "internal_reference": "057-2023-004", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "CIENTIFICA SENNA SA DE CV", "normalized_name": "CIENTIFICA SENNA", "rfc_type": null, "slug": "cientifica-senna" }, "contract_period": { "published_at": "2023-06-21T21:33:14.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "57580", "tax": "9212.8", "total": "66792.8", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "ATCC ENTEROCOCCUS FAECALIS MARCA ATCC CATÁLOGO ATCC 29212 TUBO CON LIOFILIZADO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5500", "subtotal": "5500", "tax": "880", "other_taxes": null, "total": "6380", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ATCC ENTEROCOCCUS FAECALIS MARCA ATCC CATÁLOGO ATCC 33186 TUBO CON LIOFILIZADO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4900", "subtotal": "4900", "tax": "784", "other_taxes": null, "total": "5684", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ATCC GEOBACILLUS STEAROTHERMOPHILUS MARCA ATCC CATÁLOGO 7953 VIAL", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4990", "subtotal": "9980", "tax": "1596.8", "other_taxes": null, "total": "11576.8", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ATCC MELISSOCOCCUS PLUTONIUS MARCA ATCC CATÁLOGO 35311 VIAL LIOFILIZADO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "26800", "subtotal": "26800", "tax": "4288", "other_taxes": null, "total": "31088", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ATCC SALMONELLA ENTERICA SUBSP. ENTERICA (EX KAUFFMANN AND EDWARDS) LE MINOR AND POPOFF SEROVAR TYPHIMURIUM MARCA ATCC CATÁLOGO ATCC 14028 TUBO CON LIOFILIZADO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4900", "subtotal": "4900", "tax": "784", "other_taxes": null, "total": "5684", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "ATCC STREPTOCOCCUS PYOGENES MARCA ATCC CATÁLOGO ATCC 19615 TUBO CON LIOFILIZADO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5500", "subtotal": "5500", "tax": "880", "other_taxes": null, "total": "6380", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2023-00045490", "internal_reference": "057-2023-005", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "DETECCION MOLECULAR Y ASESORIA ANALITICA SA DE CV", "normalized_name": "DETECCION MOLECULAR Y ASESORIA ANALITICA", "rfc_type": null, "slug": "deteccion-molecular-y-asesoria-analitica" }, "contract_period": { "published_at": "2023-06-07T23:55:38.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "301972", "tax": "48315.52", "total": "350287.52", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "ROCHE KIT PARA EXTRACCIÓN DE RNA MARCA ROCHE CATÁLOGO 11858882001 KIT", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10714", "subtotal": "10714", "tax": "1714.24", "other_taxes": null, "total": "12428.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "ROCHE REALTIME READY RNA VIRUS MASTER MARCA ROCHE CATÁLOGO 5619416001 KIT 10 REACCIONES", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "7590", "subtotal": "22770", "tax": "3643.2", "other_taxes": null, "total": "26413.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0048", "description": "ROCHE TUBOS CON PERLAS DE LISADO MARCA ROCHE CATÁLOGO 3358941001 PAQUETE 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "27", "awarded_quantity": null, "unit_price": "9944", "subtotal": "268488", "tax": "42958.08", "other_taxes": null, "total": "311446.08", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2023-00045492", "internal_reference": "057-2023-006", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "HYGIENA MEXICO SA DE CV", "normalized_name": "HYGIENA MEXICO", "rfc_type": null, "slug": "hygiena-mexico" }, "contract_period": { "published_at": "2023-06-07T23:57:39.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "1127870", "tax": "180459.2", "total": "1308329.2", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "HYGIENA BAX PCR ASSAY REAL TIME STEC PANEL 2 48 REACCIONES PCR BAX MARCA HYGIENA CATÁLOGO KIT 2009/D14642987 KIT 48 REACCIONES", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "18191", "subtotal": "54573", "tax": "8731.68", "other_taxes": null, "total": "63304.68", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "HYGIENA BAX REAL TIME PCR ASSAY STEC SCREENING STX Y EAE MARCA HYGIENA CATÁLOGO KIT 2021/D14642964 KIT 96 REACCIONES", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "36383", "subtotal": "36383", "tax": "5821.28", "other_taxes": null, "total": "42204.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "HYGIENA BAX SYSTEM PCR ASSAY REAL TIME L. MONOCYTOGENES MARCA HYGIENA CATÁLOGO KIT 2005/D15134303 PIEZAS KIT 96 REACCIONES", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "36383", "subtotal": "109149", "tax": "17463.84", "other_taxes": null, "total": "126612.84", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "HYGIENA BAX SYSTEM PCR ASSAY REAL TIME SALMONELLA MARCA HYGIENA CATÁLOGO KIT 2006/D14306040 PIEZAS KIT 96 REACCIONES", "unit": "LITRO", "requested_quantity": "23", "awarded_quantity": null, "unit_price": "36383", "subtotal": "836809", "tax": "133889.44", "other_taxes": null, "total": "970698.44", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "HYGIENA BAX SYSTEM PCR ASSAY REAL TIME STEC PANEL 1 48 REACCIONES PCR BAX®SYSTEM MARCA HYGIENA CATÁLOGO KIT 2008/D14642970 KIT 48 REACCIONES", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "18191", "subtotal": "54573", "tax": "8731.68", "other_taxes": null, "total": "63304.68", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "HYGIENA BAX SYSTEM REAL TIME PCR ASSAY MARCA HYGIENA CATÁLOGO KIT 2000 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "36383", "subtotal": "36383", "tax": "5821.28", "other_taxes": null, "total": "42204.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2023-00046767", "internal_reference": "057-2023-007", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "MOTIBUS SA DE CV", "normalized_name": "MOTIBUS", "rfc_type": null, "slug": "motibus" }, "contract_period": { "published_at": "2023-06-08T00:00:50.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "2670000", "tax": "427200", "total": "3097200", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "RANDOX KIT 19 NORTESTOSTERONE MARCA RANDOX CATÁLOGO NT2105 KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "17800", "subtotal": "267000", "tax": "42720", "other_taxes": null, "total": "309720", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "RANDOX KIT DE ELISA CLENBUTEROL MARCA RANDOX CATÁLOGO CB1418 KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "63", "awarded_quantity": null, "unit_price": "17800", "subtotal": "1121400", "tax": "179424", "other_taxes": null, "total": "1300824", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "RANDOX KIT DE ELISA PARA DETERMINACION ETINILESTRADIOL MARCA RANDOX CATÁLOGO RLS9225 KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "14", "awarded_quantity": null, "unit_price": "17800", "subtotal": "249200", "tax": "39872", "other_taxes": null, "total": "289072", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "RANDOX KIT DE ELISA PARA LA DETERMINACION TRENBOLONA MARCA RANDOX CATÁLOGO TB2106 KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "17800", "subtotal": "178000", "tax": "28480", "other_taxes": null, "total": "206480", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "RANDOX KIT DE ELISA PARA PHENYLBUTAZONE MARCA RANDOX CATÁLOGO PB3456 KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "9", "awarded_quantity": null, "unit_price": "17800", "subtotal": "160200", "tax": "25632", "other_taxes": null, "total": "185832", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "RANDOX KIT DE ELISA RANDOX TETRACICLINAS MARCA RANDOX CATÁLOGO TCS10117A/B KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "9", "awarded_quantity": null, "unit_price": "17800", "subtotal": "160200", "tax": "25632", "other_taxes": null, "total": "185832", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0120", "description": "RANDOX COLUMNAS INMUNOAFINIDAD PARA PROMOTORES CRECIMIENTO BOLNONA ZERANOL RACTOPAMINA Y CORTICOESTEROIS EN ORINA Y TEJIDO MARCA RANDOX CATÁLOGO GP 1821 CAJA CON 5 PIEZAS", "unit": "PIEZA", "requested_quantity": "30", "awarded_quantity": null, "unit_price": "17800", "subtotal": "534000", "tax": "85440", "other_taxes": null, "total": "619440", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2023-00046794", "internal_reference": "057-2023-008", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "OMG INTERNATIONAL SA DE CV", "normalized_name": "OMG INTERNATIONAL", "rfc_type": null, "slug": "omg-international" }, "contract_period": { "published_at": "2023-06-08T00:02:45.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "84487.77", "tax": "13518.02", "total": "98005.79", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS KIT E. COLI O103 MARCA EUROFINS ABRAXIS CATALOGO 541020, UNIDAD DE MEDIDA KIT PARA 50 PRUEBAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8716.77", "subtotal": "8716.77", "tax": "1394.68", "other_taxes": null, "total": "10111.45", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS KIT E. COLI O111 MARCA EUROFINS ABRAXIS CATALOGO 541030, UNIDAD DE MEDIDA KIT PARA 50 PRUEBAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8716.77", "subtotal": "8716.77", "tax": "1394.68", "other_taxes": null, "total": "10111.45", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS KIT E. COLI O121 MARCA EUROFINS ABRAXIS CATALOGO 541040, UNIDAD DE MEDIDA KIT PARA 50 PRUEBAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8716.77", "subtotal": "8716.77", "tax": "1394.68", "other_taxes": null, "total": "10111.45", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O145 MARCA EUROFINS ABRAXIS CATÁLOGO 541050 KIT 50 PRUEBAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8716.77", "subtotal": "8716.77", "tax": "1394.68", "other_taxes": null, "total": "10111.45", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O157:H7 MARCA EUROFINS ABRAXIS CATÁLOGO 541070 KIT 50 PRUEBAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5903.3", "subtotal": "5903.3", "tax": "944.53", "other_taxes": null, "total": "6847.83", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O26 MARCA EUROFINS ABRAXIS CATÁLOGO 541000 KIT 50 PRUEBAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8716.77", "subtotal": "8716.77", "tax": "1394.68", "other_taxes": null, "total": "10111.45", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O45 MARCA EUROFINS ABRAXIS CATÁLOGO 541010 KIT 50 PRUEBAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8716.77", "subtotal": "8716.77", "tax": "1394.68", "other_taxes": null, "total": "10111.45", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS MICROCYSTIN LR MARCA EUROFINS ABRAXIS CATALOGO 300632 AMPOLLETA 1ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4842.77", "subtotal": "4842.77", "tax": "774.84", "other_taxes": null, "total": "5617.61", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS MICROCYSTIN LW STANDARD, 10 µG / ML MARCA EUROFINS ABRAXIS CATALOGO 300650 AMPOLLETA 1ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4860.02", "subtotal": "4860.02", "tax": "777.6", "other_taxes": null, "total": "5637.62", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS MICROCYSTIN LY STANDARD, 10 µG / ML MARCA EUROFINS ABRAXIS CATALOGO 300634 AMPOLLETA 1ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4860.02", "subtotal": "4860.02", "tax": "777.6", "other_taxes": null, "total": "5637.62", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS MICROCYSTIN RR STANDARD, 10 µG / ML MARCA EUROFINS ABRAXIS CATÁLOGO 300636 AMPOLLETA 1ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4833.8", "subtotal": "4833.8", "tax": "773.41", "other_taxes": null, "total": "5607.21", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROFINS ABRAXIS PERLAS DE INMUNOSEPARACION PARA E. COLI O157:H7 MARCA EUROFINS ABRAXIS CATÁLOGO 543070 FRASCO 2 ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6887.24", "subtotal": "6887.24", "tax": "1101.96", "other_taxes": null, "total": "7989.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2023-00046805", "internal_reference": "057-2023-009", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "QUADRIX SA DE CV", "normalized_name": "QUADRIX", "rfc_type": null, "slug": "quadrix" }, "contract_period": { "published_at": "2023-06-08T00:04:31.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "1407940", "tax": "225270.4", "total": "1633210.4", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "EUROPROXIMA KIT DE ELISA PARA LA DETERMINACION AZAPERONE-AZAPEROL MARCA EUROPROXIMA CATÁLOGO 5201AZA KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "15200", "subtotal": "152000", "tax": "24320", "other_taxes": null, "total": "176320", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROPROXIMA KIT DE ELISA PARA LA DETERMINACIÓN CARAZOLOL MARCA EUROPROXIMA CATÁLOGO 5201CARA KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "15200", "subtotal": "152000", "tax": "24320", "other_taxes": null, "total": "176320", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "EUROPROXIMA KIT DE ELISA PARA LA DETERMINACION ETINILESTRADIOL MARCA EUROPROXIMA CATÁLOGO 5081ESTR KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "15700", "subtotal": "109900", "tax": "17584", "other_taxes": null, "total": "127484", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "R-BIOPHARM AFLASTANDARD 1000NG/ML -1X6ML MARCA R-BIOPHARM CATÁLOGO RBRP22 AMPOLLETA 6ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13540", "subtotal": "13540", "tax": "2166.4", "other_taxes": null, "total": "15706.4", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "R-BIOPHARM AFLATOXIN M1 STANDARD 1X6ML 1000NG/ML MARCA R-BIOPHARM CATÁLOGO TS130 AMPOLLETA 6ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13540", "subtotal": "13540", "tax": "2166.4", "other_taxes": null, "total": "15706.4", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "R-BIOPHARM DECOLORANTE MUESTRAS MARCA R-BIOPHARM CATÁLOGO R1699 KIT 400 PRUEBAS", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "6160", "subtotal": "18480", "tax": "2956.8", "other_taxes": null, "total": "21436.8", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "R-BIOPHARM KIT DE ELISA CLENBUTEROL MARCA R-BIOPHARM CATÁLOGO R1711 PIEZAS KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "43", "awarded_quantity": null, "unit_price": "14640", "subtotal": "629520", "tax": "100723.2", "other_taxes": null, "total": "730243.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "R-BIOPHARM KIT DE ELISA ESTREPTOMICINA MARCA R-BIOPHARM CATÁLOGO R3104 KIT 96 PRUEBAS", "unit": "LITRO", "requested_quantity": "9", "awarded_quantity": null, "unit_price": "16960", "subtotal": "152640", "tax": "24422.4", "other_taxes": null, "total": "177062.4", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0082", "description": "R-BIOPHARM CARTUCHOS DE EXTRACCIÓN RIDA C18 MARCA R-BIOPHARM CATÁLOGO R-2002 CAJA CON 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "27", "awarded_quantity": null, "unit_price": "6160", "subtotal": "166320", "tax": "26611.2", "other_taxes": null, "total": "192931.2", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2023-00046808", "internal_reference": "057-2023-010", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "SILVERA CIENCIA E INGENIERIA SA DE CV", "normalized_name": "SILVERA CIENCIA E INGENIERIA", "rfc_type": null, "slug": "silvera-ciencia-e-ingenieria" }, "contract_period": { "published_at": "2023-06-08T00:06:17.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "91678", "tax": "14668.48", "total": "106346.48", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "AGILENT DNA 1000 KIT MARCA AGILENT CATÁLOGO 5067-1504 KIT 300 MUESTRAS CATALOGO 5067-1504 KIT 300 MUESTRAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "27417", "subtotal": "27417", "tax": "4386.72", "other_taxes": null, "total": "31803.72", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "AGILENT HIGH SENSITIVITY DNA MARCA AGILENT CATÁLOGO 5067-4626 KIT  110 MUESTRAS", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "18724", "subtotal": "37448", "tax": "5991.68", "other_taxes": null, "total": "43439.68", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "AGILENT RNA 6000 NANO MARCA AGILENT CATÁLOGO 5067-1511 KIT 300 MUESTRAS", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "26813", "subtotal": "26813", "tax": "4290.08", "other_taxes": null, "total": "31103.08", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2023-00046826", "internal_reference": "057-2023-011", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "UNIPARTS SA DE CV", "normalized_name": "UNIPARTS", "rfc_type": null, "slug": "uniparts" }, "contract_period": { "published_at": "2023-06-08T00:07:55.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "1651081.45", "tax": "264173.09", "total": "1915254.54", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "IDT 12SPFISHFW/// 100 NMOLE DNA OLIGO /// HPLC /// CCACCTAGAGGAGCCTGTTCTAGAAC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2208.81", "subtotal": "2208.81", "tax": "353.41", "other_taxes": null, "total": "2562.22", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT 12SPFISHRV /// 100 NMOLE DNA OLIGO /// HPLC /// GACGACGGCGGTATATAGGCG. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS.MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2114.95", "subtotal": "2114.95", "tax": "338.39", "other_taxes": null, "total": "2453.34", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT 18SCIP /// 250 NM AFFINITY PLUS® 5´ HEX™ / 3´ IB®FQ /// HPLC /// 5HEX/CG CTA TTG GA+G +CT+G +GAA TTA CC/3IABKFQ/. ANALYTICAL RP-HPLC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI) MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13296.66", "subtotal": "13296.66", "tax": "2127.47", "other_taxes": null, "total": "15424.13", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT ABPV-FW /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// CAT ATT GGC GAG CCA CTA TG MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "625.72", "subtotal": "625.72", "tax": "100.12", "other_taxes": null, "total": "725.84", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT ABPV-PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/AT AGT TAA AAC AGC TTT TCA CAC TGG /3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9776.96", "subtotal": "9776.96", "tax": "1564.31", "other_taxes": null, "total": "11341.27", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT ABPV-RV /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// CTA CCA GGT TCA AAG AAA ATT TC MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "719.59", "subtotal": "719.59", "tax": "115.13", "other_taxes": null, "total": "834.72", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT BLOQUES DE GENES SINTÉTICOS MARCA IDT CATÁLOGO GBLOCKS-1 KIT", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5325.18", "subtotal": "15975.54", "tax": "2556.09", "other_taxes": null, "total": "18531.63", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT BQCV-PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/TT TCC ATC TTT ATC GGT ACG CCG CC/3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9776.96", "subtotal": "9776.96", "tax": "1564.31", "other_taxes": null, "total": "11341.27", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT CBPV-PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/TC AAG AAC GAG ACC ACC GCC AAG TTC /3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9776.96", "subtotal": "9776.96", "tax": "1564.31", "other_taxes": null, "total": "11341.27", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT CDLOOP-FW /// 100 NMOLE DNA OLIGO /// HPLC /// CCC AAT CCT AAC CCA ACT TAG ATA CC. TAMAÑO Y SECUENCIA VERIFICADOS POR\nESPECTROMETRÍA DE MASAS. PRESENTACIÓN: VIAL.\nMARCA: IDT", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2208.81", "subtotal": "2208.81", "tax": "353.41", "other_taxes": null, "total": "2562.22", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT CDLOOP-RV /// 100 NMOLE DNA OLIGO /// HPLC /// TGT GTA GGC GAG CGG TGT AA. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT CYT B-PCRV /// 100 NMOLE DNA OLIGO /// HPLC /// GGT CAA TGA ATG CGT TGT TGA T. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS.MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2133.73", "subtotal": "2133.73", "tax": "341.4", "other_taxes": null, "total": "2475.13", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT CYTB-PCP /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ///56-FAM/CC ACC CAC T/ZEN/A ATA AA/3IABKFQ /// ANALYTICAL RP-HPLC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13007.26", "subtotal": "13007.26", "tax": "2081.16", "other_taxes": null, "total": "15088.42", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT CYTB-PLPVP /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ////56-FAM/TA ATG GCA C/ZEN/C CAA CAT T/3IABKFQ /// ANALYTICAL RP-HPLC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13069.83", "subtotal": "13069.83", "tax": "2091.17", "other_taxes": null, "total": "15161", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT CYTB-PLPVRV /// 100 NMOLE DNA OLIGO /// HPLC /// CTG GGA GGT CGA TTA GGG AGT.TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2114.95", "subtotal": "2114.95", "tax": "338.39", "other_taxes": null, "total": "2453.34", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT DWV PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/CC TTG ACC AGT AGA CAC AGC ATC /3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9776.96", "subtotal": "9776.96", "tax": "1564.31", "other_taxes": null, "total": "11341.27", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT DWV-F /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// GCG GCT AAG ATT GTA AAT TG MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "625.72", "subtotal": "625.72", "tax": "100.12", "other_taxes": null, "total": "725.84", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT DWV-R /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// GTG ACT AGC ATA ACC ATG ATT A MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "688.3", "subtotal": "688.3", "tax": "110.13", "other_taxes": null, "total": "798.43", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT IAPV-FW /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// CCT ATC GCT TCA ACA TCG GAT AA. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "719.59", "subtotal": "719.59", "tax": "115.13", "other_taxes": null, "total": "834.72", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT IAPV-RV /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// GGA CCT ATC ATC CAA CCA AAG G MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "688.3", "subtotal": "688.3", "tax": "110.13", "other_taxes": null, "total": "798.43", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT KBV-FW /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// GCA ACT ATG TGC TAT CGT ATT ACG G. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "782.16", "subtotal": "782.16", "tax": "125.15", "other_taxes": null, "total": "907.31", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT KBV-RV /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// TAC CGT GGG AAT ACT TCC TGG MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "657.02", "subtotal": "657.02", "tax": "105.12", "other_taxes": null, "total": "762.14", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT ND5-PAV-FW /// 100 NMOLE DNA OLIGO /// HPLC /// TCG CAC TGT CCA TCC TCA TTC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. P MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2114.95", "subtotal": "2114.95", "tax": "338.39", "other_taxes": null, "total": "2453.34", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT ND5-POL-FW /// 100 NMOLE DNA OLIGO /// HPLC /// TCG CCC TCA CAA TCC TTA CAA. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2114.95", "subtotal": "2114.95", "tax": "338.39", "other_taxes": null, "total": "2453.34", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT NPI-FW /// 100 NMOLE DNA OLIGO /// HPLC /// GTT GAT MMA STA CAC CGG AG. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT NPI-RV /// 100 NMOLE DNA OLIGO /// HPLC /// AGG TCH CKT ATG AAG GAG TC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT NPI-S /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ///56-FAM/TA CAT AGG C/ZEN/A AAA CCA AAG GAG ACA C/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y\nELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10629.51", "subtotal": "10629.51", "tax": "1700.72", "other_taxes": null, "total": "12330.23", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT ODLOOP-FW /// 100 NMOLE DNA OLIGO /// HPLC /// ACT CCA CAA GCC CAC ATA ACA. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2114.95", "subtotal": "2114.95", "tax": "338.39", "other_taxes": null, "total": "2453.34", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT ODLOOPP /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ////56-FAM/CA TAC AAG A/ZEN/A AAG CAC AAC CAC CCA CCC AC/3IABKFQ/// ANALYTICAL RP-HPLC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13476.56", "subtotal": "13476.56", "tax": "2156.25", "other_taxes": null, "total": "15632.81", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT ODLOOP-RV /// 100 NMOLE DNA OLIGO /// HPLC /// GGG TTT ATG AAC GCT CAT GTC C. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2133.73", "subtotal": "2133.73", "tax": "341.4", "other_taxes": null, "total": "2475.13", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: 18SCI-FW: TGGTGCCAGCAGCCGC ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2021.1", "subtotal": "2021.1", "tax": "323.38", "other_taxes": null, "total": "2344.48", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: 18SCI-RV: TCCAACTACGAGCTTTTTAACTGCA ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2190.04", "subtotal": "2190.04", "tax": "350.41", "other_taxes": null, "total": "2540.45", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: BDLOOP-FW: AACCAAATATTACAAACACCACTAGCT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2227.58", "subtotal": "2227.58", "tax": "356.41", "other_taxes": null, "total": "2583.99", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: BDLOOP-RV: CCTTGCGTAGGTAATTCATTCTG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2152.49", "subtotal": "2152.49", "tax": "344.4", "other_taxes": null, "total": "2496.89", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: CITB1: CCATCCAACATCTCAGCATGAT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2133.73", "subtotal": "2133.73", "tax": "341.4", "other_taxes": null, "total": "2475.13", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: CITB2: GCCCCTCAGAATGATATTTGTC ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2133.73", "subtotal": "2133.73", "tax": "341.4", "other_taxes": null, "total": "2475.13", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: FC50 F AACGACTGTTAATACCGCATAATATCTG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3691.78", "subtotal": "3691.78", "tax": "590.68", "other_taxes": null, "total": "4282.46", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: FC50 R CCTTACCCTACCAACTAGCTAATCCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3629.2", "subtotal": "3629.2", "tax": "580.67", "other_taxes": null, "total": "4209.87", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: IHNV-FW: AGAGGGAACGAGAAAGGCA ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2077.41", "subtotal": "2077.41", "tax": "332.39", "other_taxes": null, "total": "2409.8", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: IHNV-RV: TTCCAGAAGTTCGGCGAC ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2058.64", "subtotal": "2058.64", "tax": "329.38", "other_taxes": null, "total": "2388.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: IMNV F GGACCTATCATACATAGCGTTTGCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3597.92", "subtotal": "3597.92", "tax": "575.67", "other_taxes": null, "total": "4173.59", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: IMNV R AACCCATATCTATTGTCGCTGGAT ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3566.63", "subtotal": "3566.63", "tax": "570.66", "other_taxes": null, "total": "4137.29", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: M153 FW: ATGACCGTCGCCCTCATCACESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: MCR1_320BP_REV: AGATCCTTGGTCTCGGCTTG  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2077.41", "subtotal": "2077.41", "tax": "332.39", "other_taxes": null, "total": "2409.8", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: MCR2_700BP_REV: TCTAGCCCGACAAGCATACC  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: MCR3_900BP_REV: AATGGAGATCCCCGTTTTT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2077.41", "subtotal": "2077.41", "tax": "332.39", "other_taxes": null, "total": "2409.8", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: MCR4_1100BP_REV: TTGGTCCATGACTACCAATG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: MCR5_REV:  TCATTGTGGTTGTCCTTTTCTG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2133.73", "subtotal": "2133.73", "tax": "341.4", "other_taxes": null, "total": "2475.13", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: OSHV F GTCGCATCTTTGGATTTAACAA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3504.06", "subtotal": "3504.06", "tax": "560.65", "other_taxes": null, "total": "4064.71", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: OSHV R ACTGGGATCCGACTGACAAC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3441.49", "subtotal": "3441.49", "tax": "550.64", "other_taxes": null, "total": "3992.13", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: PMARINUS F CTTTTGYTWGAGWGTTGCGAGATG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3566.63", "subtotal": "3566.63", "tax": "570.66", "other_taxes": null, "total": "4137.29", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: PMARINUS R CGAGTTTGCGAGTACCTCKAGAG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3535.35", "subtotal": "3535.35", "tax": "565.66", "other_taxes": null, "total": "4101.01", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: PVNV F TGGGAACGCTATAAGTGGTTATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3535.35", "subtotal": "3535.35", "tax": "565.66", "other_taxes": null, "total": "4101.01", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: PVNV R ATCGTCGAGAGGATCAGTATCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3504.06", "subtotal": "3504.06", "tax": "560.65", "other_taxes": null, "total": "4064.71", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: RUM16S-FW: TGGTTGTCCAGAAGATG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2039.86", "subtotal": "2039.86", "tax": "326.38", "other_taxes": null, "total": "2366.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: RUM16S-RV: ACTTTTAAARMTACAGTGRRATTTATTT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2246.36", "subtotal": "2246.36", "tax": "359.42", "other_taxes": null, "total": "2605.78", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: SHRIMP F AAGTCTAGCCTGCCCACTG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3410.21", "subtotal": "3410.21", "tax": "545.63", "other_taxes": null, "total": "3955.84", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: SHRIMP R GTCCAACCATTCATACAAGCC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3472.78", "subtotal": "3472.78", "tax": "555.64", "other_taxes": null, "total": "4028.42", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: T-GLU-PCFW: GAAAAATCATCGTTGTACTTCAACTACA ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2246.36", "subtotal": "2246.36", "tax": "359.42", "other_taxes": null, "total": "2605.78", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: TILV-93F: AGCCTGCCACACAGAAG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2039.86", "subtotal": "2039.86", "tax": "326.38", "other_taxes": null, "total": "2366.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: TILV-93R: CTGCTTGAGTTGTGCTTCT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2077.41", "subtotal": "2077.41", "tax": "332.39", "other_taxes": null, "total": "2409.8", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: VHS-FW: GCAGGRTGTGTGCGTC ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2021.1", "subtotal": "2021.1", "tax": "323.38", "other_taxes": null, "total": "2344.48", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: VHS-RV: ATCATGGTCATTCCTGTCCC ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: YHV F CGTCCCGGCAATTGTGATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3410.21", "subtotal": "3410.21", "tax": "545.63", "other_taxes": null, "total": "3955.84", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO: YHV R CCAGTGACGTTCGATGCAATA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3472.78", "subtotal": "3472.78", "tax": "555.64", "other_taxes": null, "total": "4028.42", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO:  MCR3_900BP_FW: AAATAAAAATTGTTCCGCTTATG  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2152.49", "subtotal": "2152.49", "tax": "344.4", "other_taxes": null, "total": "2496.89", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO:  MCR4_1100BP_FW: TCACTTTCATCACTGCGTTG  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO:  MCR5_FW: ATGCGGTTGTCTGCATTTATC  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2114.95", "subtotal": "2114.95", "tax": "338.39", "other_taxes": null, "total": "2453.34", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO:M154 RV: CCATCGAGCCGTTCATGATG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO:MCR1_320BP_FW:  AGTCCGTTTGTTCTTGTGGC  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT OLIGONUCLEOTIDO:MCR2_700BP_FW:  CAAGTGTGTTGGTCGCAGTT  ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2096.18", "subtotal": "2096.18", "tax": "335.39", "other_taxes": null, "total": "2431.57", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT PROBE ACTIN /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/AT CGC GCC ACC CGA GAA GAA ATA T/3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9776.96", "subtotal": "9776.96", "tax": "1564.31", "other_taxes": null, "total": "11341.27", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT PROBE IAPV /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/TG CCA GAG CAG GAA ACG ATG ACT T/3BHQ_1/. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9776.96", "subtotal": "9776.96", "tax": "1564.31", "other_taxes": null, "total": "11341.27", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT PROBE KBV /// 100 NM PRIMETIME® 5´ 6-FAM 3´ BHQ-1 /// HPLC /// 56-FAM/AA GAC AGC TTT TCA CAC AGG CAG G/3BHQ_1/. MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9776.96", "subtotal": "9776.96", "tax": "1564.31", "other_taxes": null, "total": "11341.27", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT RUM16S-P /// 250 NM AFFINITY PLUS® 5´ 6-FAM™ / 3´ IB®FQ /// HPLC /// 56-FAM/AG TTC AGC TTT AAA RA+T +A+C+C +AA/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12710.05", "subtotal": "12710.05", "tax": "2033.61", "other_taxes": null, "total": "14743.66", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SBV-FW /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// AAC GTC CAC TAC ACC GAA ATG TC MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "719.59", "subtotal": "719.59", "tax": "115.13", "other_taxes": null, "total": "834.72", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SBV-PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/TG ATG AGA GTG GAC GAA GA/3BHQ_1/ MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9776.96", "subtotal": "9776.96", "tax": "1564.31", "other_taxes": null, "total": "11341.27", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SBV-RV /// 250 NMOLE DNA OLIGO /// STANDARD DESALTING /// ACA CTG CGC GTC TAA CAT TCC MARCA: IDT PRESENTACIÓN: VIAL.", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "657.02", "subtotal": "657.02", "tax": "105.12", "other_taxes": null, "total": "762.14", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SÍNTESIS DE JUEGO DE SONDAS PARA APLICACIONES DE QPCR MARCA IDT CATÁLOGO IDT01 KIT", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "17207.44", "subtotal": "68829.76", "tax": "11012.76", "other_taxes": null, "total": "79842.52", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: BDLOOPP: 6FAM-ACATAACACGCCCATACACAGACCAC-3IABKFQ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15236.41", "subtotal": "15236.41", "tax": "2437.83", "other_taxes": null, "total": "17674.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: CDLOOPP: 6FAM-TGCATACACGTAATATTGTGTGGTGTTGGC-3IABKFQ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15236.41", "subtotal": "15236.41", "tax": "2437.83", "other_taxes": null, "total": "17674.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: TILV-93S FAM/CTCTACCAGCTAGTGCCCCA/-IOWA BLACK ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15236.41", "subtotal": "15236.41", "tax": "2437.83", "other_taxes": null, "total": "17674.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: VHS-S: FAM/ATGGGGGCG/ZEN/TTGAGGCTCA/3IABKFQ/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13132.41", "subtotal": "13132.41", "tax": "2101.19", "other_taxes": null, "total": "15233.6", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: FC50 P GTGGCCTTTGTGCTGC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15236.41", "subtotal": "15236.41", "tax": "2437.83", "other_taxes": null, "total": "17674.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: IHNV-S FAM/TCATTGCAG/ZEN/AGACGGTCCCATCGG/3IABKFQ/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15236.41", "subtotal": "15236.41", "tax": "2437.83", "other_taxes": null, "total": "17674.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: IMNV P CCACCTTTACTTTCAATACTACATCATCCCCGG ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15236.41", "subtotal": "15236.41", "tax": "2437.83", "other_taxes": null, "total": "17674.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: OSHV P TGCCCCTGTCATCTTGAGGTATAGACAATC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15236.41", "subtotal": "15236.41", "tax": "2437.83", "other_taxes": null, "total": "17674.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: PVNV P TTACGTCCCAGCGGTGCCAAATA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15236.41", "subtotal": "15236.41", "tax": "2437.83", "other_taxes": null, "total": "17674.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: SHRIMP P AGACTAATGATTATGCTACCTTCGCACGGT ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: CY5/TAO/3’ IB RQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14454.25", "subtotal": "14454.25", "tax": "2312.68", "other_taxes": null, "total": "16766.93", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "IDT SONDA: YHV P CCATCAAAGCTCTCAACGCCGTCA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATÁLOGO SÍNTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15236.41", "subtotal": "15236.41", "tax": "2437.83", "other_taxes": null, "total": "17674.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROMEGA AGUA LIBRE DE NUCLEASAS MARCA PROMEGA CATÁLOGO P1193 FRASCO 50ML", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1290.38", "subtotal": "2580.76", "tax": "412.92", "other_taxes": null, "total": "2993.68", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "PROMEGA CÉLULAS COMPETENTES JM109 MARCA PROMEGA CATÁLOGO L2005 FRASCO CON 1ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7972.2", "subtotal": "7972.2", "tax": "1275.55", "other_taxes": null, "total": "9247.75", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "PROMEGA EDTA 0.5 M MARCA PROMEGA CATÁLOGO V4231 FRASCO 100 ML", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "489.23", "subtotal": "489.23", "tax": "78.28", "other_taxes": null, "total": "567.51", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "PROMEGA GO TAQ LONG PCR MASTER MIX MARCA PROMEGA CATÁLOGO M4021 KIT 100 REACCIONES", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "10864.44", "subtotal": "32593.32", "tax": "5214.93", "other_taxes": null, "total": "37808.25", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "PROMEGA PGEM T EASY VECTOR MARCA PROMEGA CATÁLOGO A1380 KIT", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8426.43", "subtotal": "8426.43", "tax": "1348.23", "other_taxes": null, "total": "9774.66", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "PROMEGA SISTEMA COMERCIAL PARA LA PURIFICACIÓN A PARTIR DE SANGRE MARCA PROMEGA CATÁLOGO A5081 KIT", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12802.33", "subtotal": "12802.33", "tax": "2048.37", "other_taxes": null, "total": "14850.7", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "PROMEGA SISTEMA DE PURIFICACIÓN DE ADN WIZARD MARCA PROMEGA CATÁLOGO A1125 KIT PARA 500 REACCIONES", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11785.88", "subtotal": "11785.88", "tax": "1885.74", "other_taxes": null, "total": "13671.62", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "PROMEGA SOLUCIÓN DE PROTEINASA K MARCA PROMEGA CATÁLOGO A5051 FRASCO CON 23 ML", "unit": "LITRO", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "15017.4", "subtotal": "75087", "tax": "12013.92", "other_taxes": null, "total": "87100.92", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "PROMEGA SOLUCIÓN MAESTRA PARA PCR 2X CONTIENE TODOS LOS REACTIVOS PARA LA REACCIÓN EXCEPTO INICIADORES Y ADN BLANCO PARA 1000 REACCIONES (PCR MASTER MIX) MARCA PROMEGA CATÁLOGO M7505 FRASCO CON 25 ML", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "30572.46", "subtotal": "91717.38", "tax": "14674.78", "other_taxes": null, "total": "106392.16", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0048", "description": "PROMEGA COLLECTION TUBES MARCA PROMEGA CATÁLOGO A130B PAQUETE CON 250 PIEZAS", "unit": "PIEZA", "requested_quantity": "25", "awarded_quantity": null, "unit_price": "9279.27", "subtotal": "231981.75", "tax": "37117.08", "other_taxes": null, "total": "269098.83", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "PROMEGA MINICOLUMNS WIZARD SV GEL AND PCR CLEAN-UP SYSTEM MARCA PROMEGA A9281 KIT DE 50 REACCIONES", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2988.65", "subtotal": "5977.3", "tax": "956.37", "other_taxes": null, "total": "6933.67", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "PROMEGA MINICOLUMNS WIZARD SV GEL AND PCR CLEAN-UP SYSTEM MARCA PROMEGA CATÁLOGO A129B KIT 250 REACCIONES", "unit": "PIEZA", "requested_quantity": "56", "awarded_quantity": null, "unit_price": "9539.09", "subtotal": "534189.04", "tax": "85470.25", "other_taxes": null, "total": "619659.29", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "PROMEGA MINICOLUMNS WIZARD Y COLLECTION TUBES MARCA PROMEGA CATÁLOGO A1460 KIT", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "9279.27", "subtotal": "92792.7", "tax": "14846.83", "other_taxes": null, "total": "107639.53", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2023-00046829", "internal_reference": "057-2023-012", "title": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "status": "PUBLICADO", "contractor": { "name": "WATERS SA DE CV", "normalized_name": "WATERS", "rfc_type": null, "slug": "waters" }, "contract_period": { "published_at": "2023-06-08T00:09:32.000Z", "starts_at": "2023-04-27T06:00:00.000Z", "ends_at": "2023-12-31T06:00:00.000Z" }, "value": { "subtotal": "3808799.42", "tax": "609407.9", "total": "4418207.32", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "WATERS PIC A REAGENT MARCA WATERS CATÁLOGO WAT085101 PAQUETE 5 PIEZAS", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "5473.02", "subtotal": "54730.2", "tax": "8756.83", "other_taxes": null, "total": "63487.03", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0013", "description": "WATERS ACQUITY UPLC BEH C18 COLUMN, 130Å, 1.7 µM, 2.1 MM X 100 MM MARCA WATERS CATÁLOGO 186002352 PIEZA", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "26572.72", "subtotal": "212581.76", "tax": "34013.08", "other_taxes": null, "total": "246594.84", "cucop_description": "DEPOSITO SUSTANCIAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "WATERS ACQUITY UPLC BEH C18 VANGUARD PRE-COLUMN 130Å 1.7 µM 2.1 MM X 5 MM MARCA WATERS CATÁLOGO 186003975 PAQUETE 3 PIEZAS", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "19312.21", "subtotal": "154497.68", "tax": "24719.63", "other_taxes": null, "total": "179217.31", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "WATERS ACQUITY UPLC BEH PHENYL 1.7 µM 2.1 MM X 100 MM COLUMN MARCA WATERS CATÁLOGO 186002885 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "26572.72", "subtotal": "53145.44", "tax": "8503.27", "other_taxes": null, "total": "61648.71", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "WATERS ACQUITY UPLC BEH SHIELD RP18 VANGUARD PRE-COLUMN 130Å 1.7 µM 2.1 MM X 5 MM MARCA WATERS CATÁLOGO 186003977 PAQUETE 3 PIEZAS", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "19312.21", "subtotal": "77248.84", "tax": "12359.81", "other_taxes": null, "total": "89608.65", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0013", "description": "WATERS ACQUITY UPLC HSS PFP COLUMN, 100Å, 1.8 µM, 2.1 MM X 100 MM, 1/PKG MARCA WATERS CATÁLOGO 1860005967 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "26572.72", "subtotal": "26572.72", "tax": "4251.64", "other_taxes": null, "total": "30824.36", "cucop_description": "DEPOSITO SUSTANCIAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0061", "description": "WATERS ACRODISCOS PTFE 0,45µM X 4MM MARCA WATERS CATÁLOGO WAT200508 PAQUETE 250PZ", "unit": "PIEZA", "requested_quantity": "14", "awarded_quantity": null, "unit_price": "11959.57", "subtotal": "167433.98", "tax": "26789.44", "other_taxes": null, "total": "194223.42", "cucop_description": "ACRODISCOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0061", "description": "WATERS ACRODISCOS PTFE DE 13MM, 0.2µM.CON PUNTA MINISPIKE MARCA WATERS CATÁLOGO WAT200824 PAQUETE 1000 PIEZAS", "unit": "PIEZA", "requested_quantity": "11", "awarded_quantity": null, "unit_price": "34091.21", "subtotal": "375003.31", "tax": "60000.53", "other_taxes": null, "total": "435003.84", "cucop_description": "ACRODISCOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0061", "description": "WATERS ACRODISCOS PVDF DE 13 MM, 0.2 µM MARCA WATERS CATÁLOGO WAT200806 PAQUETE 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6855.1", "subtotal": "13710.2", "tax": "2193.63", "other_taxes": null, "total": "15903.83", "cucop_description": "ACRODISCOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0061", "description": "WATERS ACTIVE PREHEATER (APH), SS, .003 IN ID X 12.5 IN, WITH GASKET - PLUS MARCA WATERS CATÁLOGO 205001757 PIEZA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "26093.59", "subtotal": "78280.77", "tax": "12524.92", "other_taxes": null, "total": "90805.69", "cucop_description": "ACRODISCOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0105", "description": "WATERS ASSY NEEDLE SAMPLE MARCA WATERS CATÁLOGO 700002644 PIEZA", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "4164.66", "subtotal": "62469.9", "tax": "9995.18", "other_taxes": null, "total": "72465.08", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0095", "description": "WATERS BLUE 12 X 32MM SCREW NECK CAP AND PRESLIT PTFE/SILICONE SEPTUM MARCA WATERS CATÁLOGO 186000305 CAJA 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "75", "awarded_quantity": null, "unit_price": "1031.95", "subtotal": "77396.25", "tax": "12383.4", "other_taxes": null, "total": "89779.65", "cucop_description": "PUNTAS PARA MICROPIPETA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "WATERS CARTUCHOS DE ALUMINA B SEP-PAK CLASSIC MARCA WATERS CATÁLOGO WAT051820 CAJA 50 PIEZAS", "unit": "PIEZA", "requested_quantity": "29", "awarded_quantity": null, "unit_price": "5731.01", "subtotal": "166199.29", "tax": "26591.89", "other_taxes": null, "total": "192791.18", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "WATERS CARTUCHOS DE EXTRACCIÓN DE FASE SÓLIDA OASIS HLB 6 CC (200 MG) MARCA WATERS CATÁLOGO WAT106202 CAJA 30 PIEZAS", "unit": "PIEZA", "requested_quantity": "130", "awarded_quantity": null, "unit_price": "5067.61", "subtotal": "658789.3", "tax": "105406.29", "other_taxes": null, "total": "764195.59", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "WATERS CARTUCHOS DE EXTRACCIÓN DE SILICA SEP-PAK VAC 6 CC (1G) MARCA WATERS CATÁLOGO WAT036910 PAQUETE 30 PIEZAS", "unit": "PIEZA", "requested_quantity": "80", "awarded_quantity": null, "unit_price": "3464.41", "subtotal": "277152.8", "tax": "44344.45", "other_taxes": null, "total": "321497.25", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "WATERS CARTUCHOS DE EXTRACCION OASIS MCX 3 CC (60MG) MARCA WATERS CATÁLOGO 186000253 CAJA 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "12", "awarded_quantity": null, "unit_price": "7997.62", "subtotal": "95971.44", "tax": "15355.43", "other_taxes": null, "total": "111326.87", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "WATERS COLUMNA ACQUITY UPLC BEH HILIC COLUMN, 130Å, 1.7 µM, 2.1 MM X 50 MM, 1/PKG MARCA WATERS CATÁLOGO 186003460 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "26001.46", "subtotal": "52002.92", "tax": "8320.47", "other_taxes": null, "total": "60323.39", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "WATERS COLUMNA ATLANTIS HILIC SILICA 3 µM 2.1X50 MM MARCA WATERS CATÁLOGO 186002011 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "17506.3", "subtotal": "17506.3", "tax": "2801.01", "other_taxes": null, "total": "20307.31", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "WATERS COLUMNA BEH C18 1.7µM 2.1X50MM MARCA WATERS CATÁLOGO 186002350 PIEZA", "unit": "PIEZA", "requested_quantity": "17", "awarded_quantity": null, "unit_price": "26001.46", "subtotal": "442024.82", "tax": "70723.97", "other_taxes": null, "total": "512748.79", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "WATERS COLUMNA CROMATOGRAFICA WATERS PAH C18, 120 Å, 3 µM, 4.6 MM X 50 MM, 1/PK MARCA WATERS CATÁLOGO 186001260 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "20196.74", "subtotal": "20196.74", "tax": "3231.48", "other_taxes": null, "total": "23428.22", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "WATERS COLUMNA HSST3 1.8µM 2.1X100MM MARCA WATERS CATÁLOGO 186003539 PIEZA", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "26572.72", "subtotal": "398590.8", "tax": "63774.53", "other_taxes": null, "total": "462365.33", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0092", "description": "WATERS CONE GAS NOZZLE (# 700004216)/XEVO MARCA WATERS CATÁLOGO 700004216 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10909.19", "subtotal": "21818.38", "tax": "3490.94", "other_taxes": null, "total": "25309.32", "cucop_description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0013", "description": "WATERS DISQUE QUECHERS, 150 MG MGSO4 & 50 MG PSA, 2 ML TUBE MARCA WATERS CATÁLOGO 186004572 CAJA 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "21", "awarded_quantity": null, "unit_price": "5215.03", "subtotal": "109515.63", "tax": "17522.5", "other_taxes": null, "total": "127038.13", "cucop_description": "DEPOSITO SUSTANCIAS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "WATERS FILTROS PARA ENTRADA DE SOLVENTE SISTEMA MARCA WATERS CATÁLOGO WAT025531 PIEZA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2285.03", "subtotal": "11425.15", "tax": "1828.02", "other_taxes": null, "total": "13253.17", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "WATERS HANDLE CONE GAS NOZZLE (XEVO SUJETADOR) MARCA WATERS CATÁLOGO 700010292 PIEZA", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "902.95", "subtotal": "5417.7", "tax": "866.83", "other_taxes": null, "total": "6284.53", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0105", "description": "WATERS JERINGA PEEK DE 30 µL MARCA WATERS CATÁLOGO 700002644 PIEZA", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "4164.66", "subtotal": "16658.64", "tax": "2665.38", "other_taxes": null, "total": "19324.02", "cucop_description": "AGUJA PARA TOMA MULTIPLE", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "WATERS LCMS CERTIFIED AMBER GLASS 12 X 32MM SCREW NECK VIAL, WITH CAP AND PRESLIT PTFE/SILICONE SEPTA, 2 ML MARCA WATERS CATÁLOGO 600000669CV PAQUETE 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2082.33", "subtotal": "10411.65", "tax": "1665.86", "other_taxes": null, "total": "12077.51", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "WATERS LCMS CERTIFIED CLEAR GLASS 12 X 32MM SCREW NECK VIAL, WITH CAP AND PRESLIT PTFE/SILICONE SEPTA, 2 ML MARCA WATERS CATÁLOGO 600000668CV PAQUETE 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "2082.33", "subtotal": "16658.64", "tax": "2665.38", "other_taxes": null, "total": "19324.02", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "WATERS PRE-COLUMNA HSST3 1.8µM 2.1X5MM MARCA WATERS CATÁLOGO 186003976 PAQUETE 3 PIEZAS", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "19312.21", "subtotal": "115873.26", "tax": "18539.72", "other_taxes": null, "total": "134412.98", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0083", "description": "WATERS SEPTAS PREHORADADAS PTFE DE SILICÓN DE PS 8 MILÍMETROS MARCA WATERS CATÁLOGO WAT058876 PAQUETE 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "663.4", "subtotal": "3317", "tax": "530.72", "other_taxes": null, "total": "3847.72", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "WATERS VIAL DE VIDRIO DE 2ML CON TAPON DE ROSCA MARCA WATERS CATÁLOGO 186000307C RACK 100 PIEZAS", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "1713.77", "subtotal": "13710.16", "tax": "2193.63", "other_taxes": null, "total": "15903.79", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "WATERS VIAL HOLDER, 48-WELL, 2ML VIAL [405003743] MARCA WATERS CATÁLOGO 700011047 PIEZA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "497.55", "subtotal": "2487.75", "tax": "398.04", "other_taxes": null, "total": "2885.79", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "JUSTIFICACIÓN DE EXCEPCIÓN", "filename": "001-Justificación-CENAPA.pdf", "availability": "available", "size_bytes": "936114", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:47:44.296Z", "updated_at": "2025-11-06T02:47:44.298Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "003-AnexoTec-CENAPA.pdf", "availability": "available", "size_bytes": "65121669", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:48:01.296Z", "updated_at": "2025-11-06T02:48:01.298Z" }, { "id": null, "annex_number": 4, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.06-292-2023_AGILENT TECHNOLOGIES MÿX SRL CV.pdf", "availability": "available", "size_bytes": "1663470", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:48:07.918Z", "updated_at": "2025-11-06T02:48:07.919Z" }, { "id": null, "annex_number": 5, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.06-294-2023_APLIED BISYSTEMS DE MÿX SRL CV..pdf", "availability": "available", "size_bytes": "1699051", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:48:15.941Z", "updated_at": "2025-11-06T02:48:15.942Z" }, { "id": null, "annex_number": 6, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.06-295-2023_BIOMERIEUX MEX S.A. DE C.V..pdf", "availability": "available", "size_bytes": "1663645", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:48:22.732Z", "updated_at": "2025-11-06T02:48:22.734Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.06-299-2023_DETECCIÿN MOLECULAR Y ASESORIA ANALITICA S.A. C.V..pdf", "availability": "available", "size_bytes": "1676362", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:48:28.547Z", "updated_at": "2025-11-06T02:48:28.548Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.06-301-2023_HYGIENA MÿXICO S.A. C.V..pdf", "availability": "available", "size_bytes": "1663961", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:48:36.874Z", "updated_at": "2025-11-06T02:48:36.875Z" }, { "id": null, "annex_number": 10, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.06-303-2023 MOTIBUS S.A. C.V..pdf", "availability": "available", "size_bytes": "1652715", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:48:42.509Z", "updated_at": "2025-11-06T02:48:42.510Z" }, { "id": null, "annex_number": 11, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.03-304-2023 OMG INTERNATIONAL S.A. C.V..pdf", "availability": "available", "size_bytes": "1662838", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:48:49.129Z", "updated_at": "2025-11-06T02:48:49.130Z" }, { "id": null, "annex_number": 12, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.06-306-2023_QUADRIX S.A. C.V..pdf", "availability": "available", "size_bytes": "1661567", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:48:55.735Z", "updated_at": "2025-11-06T02:48:55.736Z" }, { "id": null, "annex_number": 13, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.06-308-2023_SILVERIA CIENCIA E INGENIERIA S.A. C.V..pdf", "availability": "available", "size_bytes": "1675228", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:49:02.987Z", "updated_at": "2025-11-06T02:49:02.988Z" }, { "id": null, "annex_number": 14, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.06-309-2023 UNIPARTS S.A. C.V..pdf", "availability": "available", "size_bytes": "1660136", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:49:11.217Z", "updated_at": "2025-11-06T02:49:11.218Z" }, { "id": null, "annex_number": 15, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "B00.06-310-2023 WATERS S.A. C.V..pdf", "availability": "available", "size_bytes": "1669220", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:49:18.148Z", "updated_at": "2025-11-06T02:49:18.149Z" }, { "id": null, "annex_number": 15, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "Of B00 06 03 01 297 2023 SENNA.pdf", "availability": "available", "size_bytes": "146477", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T02:49:24.577Z", "updated_at": "2025-11-06T02:49:24.579Z" } ], "provenance": { "source_system": "Compras MX", "source_fetched_at": "2026-07-28T01:26:25.093Z", "last_seen_at": "2026-07-28T02:26:25.806Z", "first_seen_at": "2025-11-05T04:41:52.369Z", "detail_complete": true, "documents_complete": true, "content_changed_at": "2025-11-05T04:41:52.369Z" }, "context": { "prices": [ { "cucop_code": "25501-0017", "description": "ESPITA (LLAVE)", "priced_items": 39, "units": [ { "n": 38, "max": 66947.15, "min": 30, "p10": 100.857, "p50": 275.25, "p90": 19936.992, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 15, "p50": 225 }, "2024": { "n": 19, "p50": 219.83 }, "2025": { "n": 2, "p50": 22641.045 }, "2026": { "n": 3, "p50": 571.18 } }, "refreshed_at": "2026-09-18T22:38:28.375Z" }, { "cucop_code": "25501-0095", "description": "PUNTAS PARA MICROPIPETA", "priced_items": 1440, "units": [ { "n": 1271, "max": 231397, "min": 0.14, "p10": 181, "p50": 690, "p90": 4200, "unidad": "PIEZA" }, { "n": 154, "max": 7586.2, "min": 31, "p10": 175.751, "p50": 604.21, "p90": 1801.442, "unidad": "UNIDAD" }, { "n": 14, "max": 34912.15, "min": 120, "p10": 131.1, "p50": 1865.22, "p90": 25535.172, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 481, "p50": 680 }, "2024": { "n": 467, "p50": 723 }, "2025": { "n": 235, "p50": 720 }, "2026": { "n": 257, "p50": 584.05 } }, "refreshed_at": "2026-09-21T20:00:02.331Z" }, { "cucop_code": "25501-0082", "description": "FILTROS", "priced_items": 618, "units": [ { "n": 557, "max": 88793.1, "min": 9, "p10": 362.532, "p50": 2620, "p90": 11001, "unidad": "PIEZA" }, { "n": 56, "max": 40560, "min": 1, "p10": 855.65, "p50": 1918.5, "p90": 7385.58, "unidad": "UNIDAD" }, { "n": 4, "max": 12796.66, "min": 60, "p10": 3380.28, "p50": 11962.13, "p90": 12796.66, "unidad": "SERVICIO" } ], "price_by_year": { "2023": { "n": 178, "p50": 3463.755 }, "2024": { "n": 142, "p50": 2550.5 }, "2025": { "n": 172, "p50": 2385.49 }, "2026": { "n": 126, "p50": 2077.195 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0120", "description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "priced_items": 235, "units": [ { "n": 218, "max": 119560, "min": 70, "p10": 2133.332, "p50": 16775.36, "p90": 43309.494, "unidad": "PIEZA" }, { "n": 9, "max": 34154, "min": 6645, "p10": 8689, "p50": 14976, "p90": 29050, "unidad": "UNIDAD" }, { "n": 5, "max": 34353.94, "min": 230.55, "p10": 282.418, "p50": 404.72, "p90": 27868.316, "unidad": "METRO" } ], "price_by_year": { "2023": { "n": 70, "p50": 17769.5 }, "2024": { "n": 81, "p50": 17587 }, "2025": { "n": 57, "p50": 16610.07 }, "2026": { "n": 27, "p50": 3601.57 } }, "refreshed_at": "2026-09-18T22:38:31.345Z" }, { "cucop_code": "25501-0013", "description": "DEPOSITO SUSTANCIAS", "priced_items": 305, "units": [ { "n": 296, "max": 3817085.83, "min": 3.1, "p10": 105.34, "p50": 1327.59, "p90": 7799.15, "unidad": "PIEZA" }, { "n": 5, "max": 146551.72, "min": 1926, "p10": 2355.2, "p50": 3961, "p90": 90216.088, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 61, "p50": 824 }, "2024": { "n": 179, "p50": 1475.98 }, "2025": { "n": 52, "p50": 926.455 }, "2026": { "n": 13, "p50": 330 } }, "refreshed_at": "2026-09-18T22:38:28.375Z" }, { "cucop_code": "25501-0087", "description": "ELECTRODO DE REFERENCIA", "priced_items": 148, "units": [ { "n": 146, "max": 37965.52, "min": 3.57, "p10": 981.96, "p50": 5599.78, "p90": 17380.565, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 46, "p50": 4654.5 }, "2024": { "n": 42, "p50": 4501.405 }, "2025": { "n": 31, "p50": 6993.5 }, "2026": { "n": 29, "p50": 8534 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0083", "description": "POLIMERO (PTFE, SEPTA, FERRULES)", "priced_items": 139, "units": [ { "n": 132, "max": 45450.62, "min": 15, "p10": 229.5, "p50": 2124.335, "p90": 12784.4, "unidad": "PIEZA" }, { "n": 5, "max": 21120, "min": 1559, "p10": 3415.4, "p50": 13400, "p90": 19192, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 41, "p50": 3895 }, "2024": { "n": 37, "p50": 2561.06 }, "2025": { "n": 37, "p50": 2257 }, "2026": { "n": 24, "p50": 1372.835 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0048", "description": "TUBO MUESTRADOR", "priced_items": 1252, "units": [ { "n": 1145, "max": 114987, "min": 0.54, "p10": 154.224, "p50": 579.08, "p90": 3960.4, "unidad": "PIEZA" }, { "n": 98, "max": 8348.6, "min": 1.57, "p10": 203.1, "p50": 635.325, "p90": 3979, "unidad": "UNIDAD" }, { "n": 6, "max": 6034.48, "min": 370.23, "p10": 825.085, "p50": 2131.55, "p90": 4612.065, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 608, "p50": 462.5 }, "2024": { "n": 281, "p50": 560 }, "2025": { "n": 221, "p50": 955 }, "2026": { "n": 142, "p50": 649.01 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0105", "description": "AGUJA PARA TOMA MULTIPLE", "priced_items": 685, "units": [ { "n": 649, "max": 49571, "min": 2, "p10": 37.04, "p50": 311.69, "p90": 2720, "unidad": "PIEZA" }, { "n": 29, "max": 73204.51, "min": 38, "p10": 192.4, "p50": 464, "p90": 5800, "unidad": "UNIDAD" }, { "n": 6, "max": 196.65, "min": 63.25, "p10": 63.25, "p50": 141.45, "p90": 175.375, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 293, "p50": 298.7 }, "2024": { "n": 188, "p50": 315.25 }, "2025": { "n": 60, "p50": 455 }, "2026": { "n": 144, "p50": 300 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25101-0037", "description": "REACTIVOS ANALITICOS", "priced_items": 44908, "units": [ { "n": 37743, "max": 280215502.56, "min": 0.53, "p10": 257, "p50": 3160, "p90": 19101.912, "unidad": "PIEZA" }, { "n": 3116, "max": 389753, "min": 2.25, "p10": 400, "p50": 2371.685, "p90": 18751.455, "unidad": "LITRO" }, { "n": 2930, "max": 1567806.8, "min": 1, "p10": 120, "p50": 3200, "p90": 17597.42, "unidad": "UNIDAD" }, { "n": 249, "max": 111832796, "min": 3.81, "p10": 885.8, "p50": 31540, "p90": 8964611.16, "unidad": "SERVICIO" }, { "n": 204, "max": 48058.42, "min": 140, "p10": 516.839, "p50": 15109.01, "p90": 33997.005, "unidad": "MILILITRO" }, { "n": 147, "max": 66620.51, "min": 0.75, "p10": 294.948, "p50": 1414, "p90": 7859.608, "unidad": "GRAMO" }, { "n": 142, "max": 68318.25, "min": 12.93, "p10": 72.992, "p50": 895.05, "p90": 5181.9, "unidad": "KILOGRAMO" }, { "n": 142, "max": 24971469.93, "min": 18, "p10": 1215.2, "p50": 65495.585, "p90": 457938.306, "unidad": "LOTE" }, { "n": 65, "max": 33900, "min": 208, "p10": 647.412, "p50": 2063.45, "p90": 5323.4, "unidad": "GALON" }, { "n": 59, "max": 120750, "min": 58.5, "p10": 112.396, "p50": 1561.88, "p90": 13849.984, "unidad": "TESLA" }, { "n": 58, "max": 21600, "min": 16.04, "p10": 22.329, "p50": 110.985, "p90": 691, "unidad": "METRO CUBICO" }, { "n": 28, "max": 12722.17, "min": 119, "p10": 698.229, "p50": 1903.5, "p90": 4866.035, "unidad": "MILIGRAMO" }, { "n": 25, "max": 103489.92, "min": 1617, "p10": 11250.8, "p50": 14200.9, "p90": 57843.788, "unidad": "KILOGRAMO POR HORA" } ], "price_by_year": { "2023": { "n": 14653, "p50": 2420 }, "2024": { "n": 13438, "p50": 3500 }, "2025": { "n": 8626, "p50": 4177.3 }, "2026": { "n": 8191, "p50": 2958 } }, "refreshed_at": "2026-09-24T05:35:01.565Z" }, { "cucop_code": "25501-0039", "description": "SONDA", "priced_items": 164, "units": [ { "n": 155, "max": 8588443.13, "min": 4.5, "p10": 41.478, "p50": 895, "p90": 14033.41, "unidad": "PIEZA" }, { "n": 8, "max": 4803.77, "min": 14.23, "p10": 14.23, "p50": 19.115, "p90": 1894.731, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 60, "p50": 2001.5 }, "2024": { "n": 73, "p50": 293 }, "2025": { "n": 25, "p50": 6178.21 }, "2026": { "n": 6, "p50": 4135.9 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0047", "description": "TUBO ENSAYO", "priced_items": 942, "units": [ { "n": 872, "max": 120621, "min": 1.16, "p10": 3.356, "p50": 215.43, "p90": 2426.525, "unidad": "PIEZA" }, { "n": 65, "max": 9922.25, "min": 1.57, "p10": 2.476, "p50": 374, "p90": 2004.2, "unidad": "UNIDAD" }, { "n": 3, "max": 620689.61, "min": 15600, "p10": 56557.69, "p50": 220388.45, "p90": 540629.378, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 382, "p50": 226.085 }, "2024": { "n": 250, "p50": 255 }, "2025": { "n": 139, "p50": 100.3 }, "2026": { "n": 171, "p50": 240 } }, "refreshed_at": "2026-09-22T21:45:17.601Z" }, { "cucop_code": "25501-0077", "description": "FRASCO", "priced_items": 1085, "units": [ { "n": 1017, "max": 236206.9, "min": 0.16, "p10": 10, "p50": 185.08, "p90": 3599.4, "unidad": "PIEZA" }, { "n": 55, "max": 20078.83, "min": 3.95, "p10": 18, "p50": 360, "p90": 4443.944, "unidad": "UNIDAD" }, { "n": 8, "max": 146132, "min": 1660, "p10": 2157, "p50": 19799.03, "p90": 122882.242, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 411, "p50": 134 }, "2024": { "n": 298, "p50": 477.93 }, "2025": { "n": 196, "p50": 183.185 }, "2026": { "n": 180, "p50": 199.825 } }, "refreshed_at": "2026-09-22T21:45:17.601Z" }, { "cucop_code": "25101-0049", "description": "COMPUESTO QUIMICO", "priced_items": 9641, "units": [ { "n": 6803, "max": 446857.16, "min": 0.18, "p10": 210, "p50": 2220.54, "p90": 14850, "unidad": "PIEZA" }, { "n": 1458, "max": 234303.56, "min": 7.11, "p10": 262.741, "p50": 3321, "p90": 27897.261, "unidad": "LITRO" }, { "n": 417, "max": 107500, "min": 1.27, "p10": 13.99, "p50": 117.45, "p90": 1336.656, "unidad": "KILOGRAMO" }, { "n": 270, "max": 77586.21, "min": 72.08, "p10": 163.368, "p50": 2182.08, "p90": 12455.3, "unidad": "UNIDAD" }, { "n": 227, "max": 551727.59, "min": 46.64, "p10": 1238.41, "p50": 7942, "p90": 34884.178, "unidad": "LOTE" }, { "n": 225, "max": 28382.84, "min": 0.01, "p10": 0.6373, "p50": 830, "p90": 2675.328, "unidad": "GRAMO" }, { "n": 110, "max": 21415.86, "min": 0.01, "p10": 0.05, "p50": 119.92, "p90": 3655.8, "unidad": "MILILITRO" }, { "n": 79, "max": 179860, "min": 22, "p10": 274, "p50": 2340, "p90": 19000, "unidad": "METRO CUBICO" }, { "n": 26, "max": 16211, "min": 73, "p10": 120, "p50": 303.5, "p90": 2500.125, "unidad": "GALON" }, { "n": 17, "max": 35301000, "min": 95, "p10": 408, "p50": 77586.21, "p90": 8725440.398, "unidad": "SERVICIO" }, { "n": 3, "max": 7864, "min": 2271.25, "p10": 2292.4, "p50": 2377, "p90": 6766.6, "unidad": "MILIGRAMO" }, { "n": 3, "max": 13.99, "min": 13.99, "p10": 13.99, "p50": 13.99, "p90": 13.99, "unidad": "KILOMETRO" } ], "price_by_year": { "2023": { "n": 4558, "p50": 3176.215 }, "2024": { "n": 2176, "p50": 1743 }, "2025": { "n": 1994, "p50": 1379.41 }, "2026": { "n": 913, "p50": 1092 } }, "refreshed_at": "2026-09-25T21:00:03.055Z" }, { "cucop_code": "25501-0084", "description": "CINTA DE CARBON", "priced_items": 152, "units": [ { "n": 150, "max": 908553.35, "min": 4.1, "p10": 74.267, "p50": 536, "p90": 4900.3, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 49, "p50": 280 }, "2024": { "n": 26, "p50": 1208.3301 }, "2025": { "n": 41, "p50": 993 }, "2026": { "n": 36, "p50": 640 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0071", "description": "PLACA", "priced_items": 603, "units": [ { "n": 534, "max": 1057257.48, "min": 10, "p10": 186.2, "p50": 2586.4, "p90": 18010, "unidad": "PIEZA" }, { "n": 55, "max": 19974, "min": 180, "p10": 914.994, "p50": 1980, "p90": 6121.52, "unidad": "UNIDAD" }, { "n": 12, "max": 420267.58, "min": 1862.57, "p10": 6736.405, "p50": 97403.615, "p90": 413283.95, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 242, "p50": 2113.01 }, "2024": { "n": 196, "p50": 3455.475 }, "2025": { "n": 102, "p50": 2279 }, "2026": { "n": 63, "p50": 2060 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0061", "description": "ACRODISCOS", "priced_items": 87, "units": [ { "n": 86, "max": 57261.22, "min": 1, "p10": 2043.32, "p50": 7000, "p90": 26935.215, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 22, "p50": 8846.5 }, "2024": { "n": 28, "p50": 13000 }, "2025": { "n": 10, "p50": 10739 }, "2026": { "n": 27, "p50": 2483 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0092", "description": "MATERIAL METALICO PARA USO EN LABORATORIO DE MEDICION", "priced_items": 2167, "units": [ { "n": 2001, "max": 2625000, "min": 0.2293, "p10": 79.81, "p50": 780, "p90": 11082.17, "unidad": "PIEZA" }, { "n": 112, "max": 198300, "min": 24, "p10": 109.109, "p50": 1281.5, "p90": 6964.85, "unidad": "UNIDAD" }, { "n": 28, "max": 460678, "min": 125.84, "p10": 2020, "p50": 3550, "p90": 48837.344, "unidad": "LOTE" }, { "n": 14, "max": 2700.9222, "min": 10.69, "p10": 103.044, "p50": 257.315, "p90": 2004.7615, "unidad": "METRO" }, { "n": 10, "max": 25535, "min": 25, "p10": 77.65, "p50": 214.25, "p90": 3228.5, "unidad": "SERVICIO" } ], "price_by_year": { "2023": { "n": 672, "p50": 801 }, "2024": { "n": 456, "p50": 675.23 }, "2025": { "n": 677, "p50": 900 }, "2026": { "n": 362, "p50": 620.5 } }, "refreshed_at": "2026-09-24T21:00:04.571Z" } ], "suppliers": [ { "slug": "agilent-technologies-mexico", "name": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "total_contracts": 236, "total_awarded_amount": "200198128.45", "median_amount": "206559.16", "distinct_buyers": 40, "first_contract_at": "2023-02-16T00:00:00.000Z", "last_contract_at": "2026-09-21T00:00:00.000Z", "with_this_buyer": { "contracts": 14, "amount": "26123003.79" }, "refreshed_at": "2026-09-25T21:00:03.055Z" }, { "slug": "applied-biosystems-de-mexico", "name": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "total_contracts": 222, "total_awarded_amount": "205941008.89", "median_amount": "190943.80", "distinct_buyers": 28, "first_contract_at": "2023-01-01T00:00:00.000Z", "last_contract_at": "2026-09-25T00:00:00.000Z", "with_this_buyer": { "contracts": 35, "amount": "78443240.76" }, "refreshed_at": "2026-09-25T05:35:01.354Z" }, { "slug": "biomerieux-mexico", "name": "BIOMERIEUX MEXICO SA DE CV", "total_contracts": 69, "total_awarded_amount": "154945944.19", "median_amount": "502860.00", "distinct_buyers": 12, "first_contract_at": "2023-03-01T00:00:00.000Z", "last_contract_at": "2026-06-11T00:00:00.000Z", "with_this_buyer": { "contracts": 12, "amount": "11814943.08" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "cientifica-senna", "name": "CIENTIFICA SENNA SA DE CV", "total_contracts": 150, "total_awarded_amount": "47497739.02", "median_amount": "70203.59", "distinct_buyers": 30, "first_contract_at": "2023-02-24T00:00:00.000Z", "last_contract_at": "2026-09-15T00:00:00.000Z", "with_this_buyer": { "contracts": 12, "amount": "5371681.73" }, "refreshed_at": "2026-09-17T00:43:15.210Z" }, { "slug": "deteccion-molecular-y-asesoria-analitica", "name": "DETECCION MOLECULAR Y ASESORIA ANALITICA SA DE CV", "total_contracts": 88, "total_awarded_amount": "30664802.48", "median_amount": "114503.11", "distinct_buyers": 14, "first_contract_at": "2023-04-24T00:00:00.000Z", "last_contract_at": "2025-12-02T00:00:00.000Z", "with_this_buyer": { "contracts": 12, "amount": "15020037.38" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "hygiena-mexico", "name": "HYGIENA MEXICO SA DE CV", "total_contracts": 14, "total_awarded_amount": "19612663.19", "median_amount": "201823.47", "distinct_buyers": 1, "first_contract_at": "2023-03-23T00:00:00.000Z", "last_contract_at": "2025-04-10T00:00:00.000Z", "with_this_buyer": { "contracts": 14, "amount": "19612663.19" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "motibus", "name": "MOTIBUS SA DE CV", "total_contracts": 4, "total_awarded_amount": "5616998.40", "median_amount": "1173664.80", "distinct_buyers": 1, "first_contract_at": "2023-04-27T00:00:00.000Z", "last_contract_at": "2025-04-10T00:00:00.000Z", "with_this_buyer": { "contracts": 4, "amount": "5616998.4" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "omg-international", "name": "OMG INTERNATIONAL SA DE CV", "total_contracts": 45, "total_awarded_amount": "27304902.13", "median_amount": "93823.93", "distinct_buyers": 4, "first_contract_at": "2023-02-13T00:00:00.000Z", "last_contract_at": "2026-09-15T00:00:00.000Z", "with_this_buyer": { "contracts": 3, "amount": "1223679.18" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "quadrix", "name": "QUADRIX SA DE CV", "total_contracts": 17, "total_awarded_amount": "7918551.81", "median_amount": "133050.06", "distinct_buyers": 4, "first_contract_at": "2023-02-10T00:00:00.000Z", "last_contract_at": "2025-12-26T00:00:00.000Z", "with_this_buyer": { "contracts": 13, "amount": "7481207.3" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "silvera-ciencia-e-ingenieria", "name": "SILVERA CIENCIA E INGENIERIA SA DE CV", "total_contracts": 340, "total_awarded_amount": "81225169.30", "median_amount": "70854.54", "distinct_buyers": 41, "first_contract_at": "2023-03-10T00:00:00.000Z", "last_contract_at": "2026-09-15T00:00:00.000Z", "with_this_buyer": { "contracts": 13, "amount": "16371626.13" }, "refreshed_at": "2026-09-20T04:43:00.057Z" }, { "slug": "uniparts", "name": "UNIPARTS SA DE CV", "total_contracts": 198, "total_awarded_amount": "38076889.14", "median_amount": "66347.69", "distinct_buyers": 33, "first_contract_at": "2023-02-03T00:00:00.000Z", "last_contract_at": "2025-12-16T00:00:00.000Z", "with_this_buyer": { "contracts": 12, "amount": "11351646.93" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "waters", "name": "WATERS SA DE CV", "total_contracts": 170, "total_awarded_amount": "136386848.82", "median_amount": "260082.21", "distinct_buyers": 27, "first_contract_at": "2023-02-01T00:00:00.000Z", "last_contract_at": "2026-10-01T00:00:00.000Z", "with_this_buyer": { "contracts": 14, "amount": "59562369.59" }, "refreshed_at": "2026-09-25T20:45:03.663Z" } ], "buyer": { "slug": "senasica", "name": "SERVICIO NACIONAL DE SANIDAD, INOCUIDAD Y CALIDAD AGROALIMENTARIA", "total_procedures": 504, "distinct_suppliers": 321, "procedures_by_type": { "LICITACIÓN PÚBLICA": 103, "ADJUDICACIÓN DIRECTA": 283, "INVITACIÓN A CUANDO MENOS TRES PERSONAS": 115, "CONTRATO ESPECÍFICO DERIVADO DE ACUERDO MARCO": 3 }, "refreshed_at": "2026-09-24T00:15:06.112Z" } }, "alternates": [], "similar": [ { "numero_procedimiento": "aa-08-b00-008b00001-n-41-2024", "nombre_procedimiento": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "dependencia": "SENASICA", "siglas": "SENASICA", "score": 0.030922411029179586, "anio_ejercicio": 2024, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2024-04-25T16:43:15.000Z", "ganador": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "ganador_slug": "agilent-technologies-mexico", "ganador_rfc_type": null, "ganadores": "13", "monto_mxn": "13967975.65" }, { "numero_procedimiento": "aa-08-b00-008b00001-n-112-2025", "nombre_procedimiento": "PRODUCTOS QUÍMICOS BÁSICOS Y MATERIALES PARA LABORATORIO CENAPA MARCAS IDT", "dependencia": "SENASICA", "siglas": "SENASICA", "score": 0.12472295761107777, "anio_ejercicio": 2025, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2025-04-29T14:07:23.000Z", "ganador": "UNIPARTS SA DE CV", "ganador_slug": "uniparts", "ganador_rfc_type": null, "ganadores": "2", "monto_mxn": "2508784.53" }, { "numero_procedimiento": "aa-16-rjj-016rjj001-n-32-2024", "nombre_procedimiento": "ADQUISICIÓN DE CONSUMIBLES, MATERIALES Y REACTIVOS QUÍMICOS PARA LOS LABORATORIO", "dependencia": "INECC", "siglas": "INECC", "score": 0.14806527781875445, "anio_ejercicio": 2024, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2025-07-03T10:48:21.000Z", "ganador": "ACCESORIOS PARA LABORATORIOS SA DE CV", "ganador_slug": "accesorios-para-laboratorios", "ganador_rfc_type": null, "ganadores": "14", "monto_mxn": "6170626.15" }, { "numero_procedimiento": "aa-16-rjj-016rjj001-n-45-2025", "nombre_procedimiento": "ADQUISICIÓN DE MATERIALES Y SUSTANCIAS PARA LA IMPLEMENTACIÓN Y REALIZACIÓN", "dependencia": "INSTITUTO NACIONAL DE ECOLOGIA Y CAMBIO CLIMATICO", "siglas": "INECC", "score": 0.15085349835635664, "anio_ejercicio": 2025, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2025-09-04T19:55:15.000Z", "ganador": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "ganador_slug": "agilent-technologies-mexico", "ganador_rfc_type": null, "ganadores": "6", "monto_mxn": "1014740.55" }, { "numero_procedimiento": "aa-12-nck-012nck001-i-75-2024", "nombre_procedimiento": "ADQUISICIÓN DE SUSTANCIAS QUÍMICAS Y MATERIAL DE LABORATORIO 2024.", "dependencia": "INSTITUTO NACIONAL DE NEUROLOGÍA Y NEUROCIRUGÍA MANUEL VELASCO SUÁREZ", "siglas": "INNN", "score": 0.15646474620908668, "anio_ejercicio": 2024, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": "2024-06-05T16:00:00.000Z", "fecha_publicacion": "2024-08-22T17:36:53.000Z", "ganador": "ABYNTECH SA DE CV", "ganador_slug": "abyntech", "ganador_rfc_type": null, "ganadores": "7", "monto_mxn": "4470340.35" }, { "numero_procedimiento": "aa-08-b00-008b00001-n-42-2024", "nombre_procedimiento": "ADQUISICIÓN DE SUSTANCIAS QUÍMICAS PARA EL (CNRIBA) 2024", "dependencia": "SENASICA", "siglas": "SENASICA", "score": 0.1590174626132801, "anio_ejercicio": 2024, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2024-04-11T10:17:30.000Z", "ganador": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "ganador_slug": "agilent-technologies-mexico", "ganador_rfc_type": null, "ganadores": "12", "monto_mxn": "17913860.57" } ] }