{ "html_url": "https://postor.com.mx/adjudicacion/aa-08-b00-008b00001-n-41-2024", "canonical": "https://postor.com.mx/adjudicacion/aa-08-b00-008b00001-n-41-2024", "id": "72817a52b8c94080ac49883da0fae7d6", "procedure_number": "AA-08-B00-008B00001-N-41-2024", "file_number": "E-2024-00032522", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "description": { "short": "No existen bienes alternativos o sustitutos, Único Oferente, Derechos exclusivos (patentes, licencias, derechos de autor u otros derechos exclusivos), o por obras de arte.", "detailed": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO", "moved_at": null }, "buyer": { "agency": "SENASICA", "acronym": "SENASICA", "branch": "08 - AGRICULTURA Y DESARROLLO RURAL", "buying_unit": "DIRECCIÓN DE RECURSOS MATERIALES Y SERVICIOS GENERALES", "requesting_unit": null, "requesting_group": "DIRECCIÓN DE RECURSOS MATERIALES Y SERVICIOS GENERALES", "entity": "TESORERÍA DE LA FEDERACIÓN", "slug": "senasica", "unit_slug": "direccion-de-recursos-materiales-y-servicios-generales-008b00001" }, "classification": { "procedure_type": "ADJUDICACIÓN DIRECTA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "NACIONAL", "fiscal_year": 2024, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": "22", "exception_basis": "Art. 41 fr. I", "internal_control_number": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "supply_source_number": null }, "schedule": { "published_at": "2024-04-25T22:43:15.000Z", "clarification_meeting_at": null, "clarification_questions_deadline_at": null, "clarification_responses_deadline_at": null, "bid_opening_at": null, "award_at": null, "estimated_contract_at": "2024-02-28T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "locations": { "state_id": "7", "state": "CIUDAD DE MÉXICO", "bid_opening": null, "award": null, "clarification_meeting": null, "site_visit": null, "work_site": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "financial_terms": { "currency": "MXN", "advance_percentage": "0", "supplier_percentage": "10", "payment_method": "TRANSFERENCIA ELECTRONICA", "credit_condition": null, "payment_conditions": null, "financing_organization": null }, "evaluation": { "criterion": "BINARIO", "technical_points": null, "economic_points": null }, "guarantees": { "performance_required": true, "goods_or_services_required": false, "amount_percentage": null, "delivery_days": "10", "term_months": null, "other_insurance_required": false, "other_insurance_description": null, "performance_reduction": null }, "participation": { "method": null, "joint": false, "msme_only": false, "social_witness": false, "multi_year": false, "open_contract": false, "consolidated_purchase": false, "external_credit": false, "simultaneous_supply": false, "subcontracting": null, "emergency": false, "proposal_language": "idioma data", "no_joint_participation_justification": null }, "execution": { "site_visit_required": null, "duration_days": null, "procurement_term": "Normal", "subcontracted_work": null, "deadline_justification": null }, "lots": [ { "number": "1", "name": "PARTIDA SOLA", "description": "PARTIDA SOLA", "requirement_group_id": "1", "items": [ { "number": "1", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, QUECHERS EXTRACTION PACKETS, AOAC MARCA AGILENT CATALOGO 5982-7755 PIEZA (PAQUETE 200 PIEZAS), MARCA AGILENT, CADUCIDAD 12 MESES, 15 PIEZA", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "2", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "01.AGILENT TECHNOLOGIES MÉXICO, BOND ELUT  CERTIFY, 500 MG, 6 ML MARCA AGILENT CATALOGO 12102093 PIEZA (PAQUETE 30 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 60 PIEZA", "requested_quantity": "60", "minimum_quantity": "60", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "3", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, INSERTO DE VIDRIO DE 400 MICROLITROS MARCA AGILENT CATALOGO 5181-3377 PIEZA (PAQUETE 500 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 100 PIEZA", "requested_quantity": "100", "minimum_quantity": "100", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "4", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, CARTUCHOS DE EXTRACCIÓN BOND-ELUT MEGA BE-C18, 1GM 6ML MARCA AGILENT CATALOGO 12256001 PIEZA (CAJA 30 PIEZA), MARCA AGILENT, CADUCIDAD N/A, 40 PIEZA", "requested_quantity": "40", "minimum_quantity": "40", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "5", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, SPE DISPERSIVA 15ML, GRASA/PIGMENT, AOAC MARCA AGILENT CATALOGO 5982-5456 PIEZA (PAQUETE 50 PIEZAS), MARCA AGILENT, CADUCIDAD 12 MESES, 15 PIEZA", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "6", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, CARTUCHOS DE EXTRACCIÓN BOND ELUT-SAX 500MG/ 3ML MARCA AGILENT CATALOGO 12102044 PIEZA (CAJA 50 CARTUCHOS), MARCA AGILENT, CADUCIDAD N/A, 10 PIEZA", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "7", "cucop_code": "25501-0007", "specific_item_code": "25501", "cucop_description": "CARGADOR DE DOSIMETROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, DB5-MS 30 MTS LENGTH; 0,250 MM NARROWBORE; FILM 0,25 MICROMETROS, LIMITES DE TEMPERATURA -60 A 325 °C (350 °C) MARCA AGILENT CATALOGO 122-5532 PIEZA, MARCA AGILENT, CADUCIDAD N/A, 2 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "8", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, CARTUCHOS DE EXTRACCIÓN BOND ELUT-SCX 500MG/3ML MARCA AGILENT CATALOGO 12102040 PIEZA (CAJA 50 CARTUCHOS), MARCA AGILENT, CADUCIDAD N/A, 4 PIEZA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "9", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "01.AGILENT TECHNOLOGIES MÉXICO, VIAL DE VIDRIO TRANSPARENTE DE 2 ML CON TAPON DE ROSCA AZUL Y SEPTA PTFE/GOMA DE SILICONA ROJA PARA AUTOMUESTREADOR MARCA AGILENT CATALOGO 5182-0553 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 15 PIEZA", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "10", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, QUECHERS EXTRACTION SALT PACKETS EN METHOD MARCA AGILENT CATALOGO 5982-6650 PIEZA (PAQUETE 50 PIEZAS), MARCA AGILENT, CADUCIDAD 12 MESES, 5 PIEZA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "11", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, CARTUCHOS DE EXTRACCIÓN C2 500MG /3ML MARCA AGILENT CATALOGO 12102030 PIEZA (CAJA 50 PIEZA), MARCA AGILENT, CADUCIDAD N/A, 5 PIEZA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "12", "cucop_code": "25501-0067", "specific_item_code": "25501", "cucop_description": "MARCADOR DE PESO MOLECULAR", "description": "01.AGILENT TECHNOLOGIES MÉXICO, HOMOGENIZADORES CERAMICOS TUBOS 50 ML MARCA AGILENT CATALOGO 5982-9313 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 15 PIEZA", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "13", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, QUECHERS DISPERSIVE SPE 15 ML FRUITS AND VEGETABLES AOAC METHOD MARCA AGILENT CATALOGO 5982-5058 PIEZA (CAJA 50 PIEZAS), MARCA AGILENT, CADUCIDAD 12 MESES, 5 PIEZA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "14", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "01.AGILENT TECHNOLOGIES MÉXICO, COLUMNA ZORBAX ECLIPSE PAH (4.6 X 50 MM, 1.8 µM) MARCA AGILENT CATALOGO 959941-918 PIEZA, MARCA AGILENT, CADUCIDAD N/A, 1 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "15", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, INSERTO CÓNICO 300 µL 5.6X30MM CON PIÉ DE POLIPROPILENO MARCA AGILENT CATALOGO 5182-0549 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 20 PIEZA", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "16", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "01.AGILENT TECHNOLOGIES MÉXICO, COLUMNA CROMATOGRAFICA ZORBAX ECLIPSE PLUS C18, RAPID RESOLUTION, 4.6 X 100 MM, 3.5 MICRAS MARCA AGILENT CATALOGO 959961-902 PIEZA, MARCA AGILENT, CADUCIDAD N/A, 1 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "17", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "01.AGILENT TECHNOLOGIES MÉXICO, VIAL DE VIDRIO COLOR AMBAR CON TAPÓN CERRADO DE 22ML MARCA AGILENT CATALOGO 5183-4323 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 5 PIEZA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "18", "cucop_code": "25501-0083", "specific_item_code": "25501", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "description": "01.AGILENT TECHNOLOGIES MÉXICO, FERRULE PARA CROMATÓGRAFO DE GASES GC/MS, 0,25 MM DE DI, 1/16 PULG. X 0,40 MM, 10/PAQ. MARCA AGILENT CATALOGO 5062-3508 PIEZA (PAQUETE 10 PIEZA), MARCA AGILENT, CADUCIDAD N/A, 6 PIEZA", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "19", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "01.AGILENT TECHNOLOGIES MÉXICO, VIAL DE VIDRIO AMBAR CON TAPON DE ROSCA VERDE Y SEPTA PTFE/GOMA SILICONA ROJA MARCA AGILENT CATALOGO 5182-0554 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 6 PIEZA", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "20", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, FC43 O PFTBA MARCA AGILENT CATALOGO 05971-60571 AMPOLLETA, MARCA AGILENT, CADUCIDAD 12 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "21", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "01.AGILENT TECHNOLOGIES MÉXICO, INSERTO VIAL DE 100 UL MARCA AGILENT CATALOGO 5183-2085 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 4 PIEZA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "22", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "01.AGILENT TECHNOLOGIES MÉXICO, TUBO DE BOMBA PERISTÁLTICA, PVC, AZUL/ AZUL PUENTEADOS CON PESTAÑAS PARA MUESTRAS DE AGUA MARCA AGILENT CATALOGO 3710034600 PIEZA (BOLSA 12 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 1 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "23", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "02.ANALITEK, NEXTERA® XT DNA SAMPLE PREPARATION KIT MARCA ILLUMINA CATALOGO FC-131-1096 KIT, MARCA ILLUMINA, CADUCIDAD 10 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "24", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "02.ANALITEK, MISEQ REAGENT KIT V3 (600-CYCLE) MARCA ILLUMINA CATALOGO MS-102-3003 KIT, MARCA ILLUMINA, CADUCIDAD 6 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "25", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "02.ANALITEK, MISEQ REAGENT KIT V2 (500-CYCLES) MARCA ILLUMINA CATALOGO MS-102-2003 KIT, MARCA ILLUMINA, CADUCIDAD 6 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "26", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "02.ANALITEK, MISEQ REAGENT NANO KIT V2 (500- CYCLES) MARCA ILLUMINA CATALOGO MS-103-1003 KIT, MARCA ILLUMINA, CADUCIDAD 6 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "27", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "02.ANALITEK, PHIX CONTROL V3 MARCA ILLUMINA CATALOGO FC-110-3001 KIT, MARCA ILLUMINA, CADUCIDAD 10 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "28", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, MEZCLA MAESTRA EN UN SOLO PASO EN FORMATO TAQMAN PARA DETECCION DE VIRUS EN FORMATO FAST MARCA APPLIED BIOSYSTEMS CATALOGO 4444436 TUBO 10 ML, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 12 MESES, 7 LITRO", "requested_quantity": "7", "minimum_quantity": "7", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "29", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, TUBO CÓNICOS PARA CENTRÍFUGA FALCON™ DE 15ML MARCA THERMO FISHER SCIENTIFIC CATALOGO 339651 PIEZA (PAQUETE 500 PIEZAS), MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD N/A, 30 PIEZA", "requested_quantity": "30", "minimum_quantity": "30", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "30", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, MEZCLA MAESTRA PARA SISTEMAS TAQMAN EN FORMATO FAST ADVANCED MARCA APPLIED BIOSYSTEMS CATALOGO 4444963 PAQUETE 2 UNIDADES DE 5ML, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 12 MESES, 6 LITRO", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "31", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, BUFFER DE SECUENCIACIÓN & TF, BDT V3.1 RR-100 MARCA APPLIED BIOSYSTEMS CATALOGO 4337455 KIT 100 REACCIONES, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 10 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "32", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, AGAROSA ULTRAPURA MARCA INVITROGEN CATALOGO 16500-500 LITRO (FRASCO 500 G), MARCA INVITROGEN, CADUCIDAD 12 MESES, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "33", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, MEZCLA MAESTRA AGPATH-ID™ ONE-STEP RT-PCR REAGENTS MARCA THERMO SCIENTIFIC APPLIED BIOSYSTEM CATALOGO 4387391 PIEZA, MARCA THERMO FISHER SCIENTIFIC , CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "34", "cucop_code": "25501-0071", "specific_item_code": "25501", "cucop_description": "PLACA", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, PLACA DE 96 POZOS PARA MICROAMPLIFICACION MARCA APPLIED BIOSYSTEMS CATALOGO 4346906 PIEZA (CAJA 20 PIEZAS), MARCA APPLIED BIOSYSTEMS, CADUCIDAD N/A, 20 PIEZA", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "35", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, GENERULER 100 BP DNA LADDER MARCA THERMO FISHER SCIENTIFIC CATALOGO SM0322  PAQUETE 5 PIEZA, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 12 MESES, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "36", "cucop_code": "25501-0103", "specific_item_code": "25501", "cucop_description": "PAPEL PARAFILM", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, FG-CUBIERTAS ADHESIVAS OPTICAS MARCA APPLIED BIOSYSTEMS CATALOGO 4311971 PIEZA (PAQUETE 100 PIEZAS), MARCA APPLIED BIOSYSTEMS, CADUCIDAD 12 MESES, 4 PIEZA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "37", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, PASTILLAS DE AGROSA TOPVISIÓN MARCA THERMO FISHER SCIENTIFIC CATALOGO R2802 CAJA 1000 TABLETAS, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "38", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, POLIMERO POP 7 MARCA APPLIED BIOSYSTEMS CATALOGO 4393708 PIEZA, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 10 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "39", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, MEZCLA MAESTRA DREAMTAQ GREEN PCR (2X) MARCA THERMO FISHER SCIENTIFIC CATALOGO K1081 TUBO, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "40", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, PV-1 PERFORMANCE VERIFICATION SOLUTION MARCA THERMO FISHER SCIENTIFIC CATALOGO CHEM-PV-1 AMPOLLETA 0.5 ML, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 12 MESES, 5 LITRO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "41", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, ENZIMA DE RESTRICCIÓN MBOI RECONOCE Y CORTA LA SECUENCIA GATC MARCA INVITROGEN CATALOGO IVGN0554 PIEZA, MARCA INVITROGEN, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "42", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, ENZIMA DE RESTRICCIÓN ANZA 44 ALUI MARCA INVITROGEN CATALOGO IVGN0446 PIEZA, MARCA INVITROGEN, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "43", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, ENZIMA DE RESTRICCIÓN ANZA 42 RSAI MARCA INVITROGEN CATALOGO IVGN0426 PIEZA, MARCA INVITROGEN, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "44", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, QUBIT DSDNA HS ASSAY KIT MARCA THERMO FISHER SCIENTIFIC CATALOGO Q32854 PIEZA KIT 500 REACCIONES, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "45", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, KIT ACONDICIONADOR NANODROP™ PR-1 MARCA THERMO FISHER SCIENTIFIC CATALOGO CHEM-PR1-KIT KIT, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 10 MESES, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "46", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, ESTÁNDAR DE ADN DE 100 BP MARCA INVITROGEN CATALOGO 15628050 TUBO 250 µG, MARCA INVITROGEN, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "47", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, AGUA LIBRE DE NUCLEASAS DEPC MARCA INVITROGEN CATALOGO AM9922 LITRO (FRASCO 1 L), MARCA INVITROGEN, CADUCIDAD 10 MESES, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "48", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, LÍQUIDO DE CALIBRACIÓN NANODROP™ CF-1 MARCA THERMO FISHER SCIENTIFIC CATALOGO CHEM-CF-1 AMPOLLETA 0.5 ML, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 10 MESES, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "49", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, TBE 10 X GRADO BIOLOGIA MOLECULAR MARCA INVITROGEN CATALOGO 15581044 FRASCO 1 L, MARCA INVITROGEN, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "50", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, SOLUCIÓN DE LISOZIMA DE 50MG/ML MARCA THERMO FISHER SCIENTIFIC CATALOGO 90082 VIAL 0.5ML, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 10 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "51", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, REACTIVO DE ACONDICIONAMIENTO PARA 3,500-SEQSTUDIO MARCA APPLIED BIOSYSTEMS CATALOGO 4393718 PIEZA, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 10 MESES, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "52", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, DNA GEL LOADING DYE (6X) MARCA THERMO FISHER SCIENTIFIC CATALOGO R0611 PAQUETE 5 PIEZA, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 10 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "53", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, HI-DI FORMAMIDA MARCA APPLIED BIOSYSTEMS CATALOGO 4440753 KIT 5 ML, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "54", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "04.BIOMERIUX, API 20E ENTEROBACTERIAS MARCA BIOMERIEUX CATALOGO 20100 KIT , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 11 LITRO", "requested_quantity": "11", "minimum_quantity": "11", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "55", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "04.BIOMERIUX, API LISTERIA MARCA BIOMERIEUX CATALOGO 10300 CAJA 25 PIEZA, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "56", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "04.BIOMERIUX, API 50 CH MARCA BIOMERIEUX CATALOGO OT-50300 CAJA 10 TIRAS, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "57", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "04.BIOMERIUX, API® 20 A IDENTIFICACIÓN DE BACTERIAS ANAEROBIAS EN 24-48 HORA MARCA BIOMERIEUX CATALOGO 20300 CAJA 25 GALERÍAS , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "58", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "04.BIOMERIUX, API 20 STREP MARCA BIOMERIEUX CATALOGO 20600 CAJA 25 GALERÍAS , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "59", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "04.BIOMERIUX, API ESTAFILOCOCOS MARCA BIOMERIEUX CATALOGO 20500 CAJA 25 GALERÍAS , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "60", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "04.BIOMERIUX, API 20E REAGENTS MARCA BIOMERIEUX CATALOGO 20120 KIT , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "61", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "04.BIOMERIUX, API 50 CHB/E MEDIUM MARCA BIOMERIEUX CATALOGO OT-50430 CAJA C/10 AMPOLLETAS DE 10ML , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "62", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "04.BIOMERIUX, ZYM A X 2 MARCA BIOMERIEUX CATALOGO 70494 2 AMPOLLETA DE 5ML, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "63", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "04.BIOMERIUX, REACTIVO NIN X 2 (NINHIDRINA) MARCA BIOMERIEUX CATALOGO 70491 2 AMPOLLETA DE 5ML, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "64", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "04.BIOMERIUX, XYL (XILENO) MARCA BIOMERIEUX CATALOGO 70530 2 AMPOLLETA DE 5ML, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "65", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "04.BIOMERIUX, BCP (PÚRPURA BROMOCRESOL) MARCA BIOMERIEUX CATALOGO 70510 AMPOLLETA 5 ML, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "66", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "05.CIENTÍFICA SENNA, CAMPYLOBACTER COLY MARCA ATCC CATALOGO 33559 VIAL, MARCA ATCC, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "67", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "05.CIENTÍFICA SENNA, SALMONELLA ABAETETUBA ENTERICA MARCA ATCC CATALOGO 35640 VIAL, MARCA ATCC, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "68", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "05.CIENTÍFICA SENNA, SALMONELLA ENTERICA SUBSP. ENTERICA SEROVAR TYPHIMURUM MARCA ATCC CATALOGO 14028 TUBO 0.25 ML, MARCA ATCC, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "69", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "05.CIENTÍFICA SENNA, CAMPYLOBACTER JEJUNI MARCA ATCC CATALOGO 33291 VIAL, MARCA ATCC, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "70", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "05.CIENTÍFICA SENNA, CAMPYLOBACTER LARI BENJAMIN ET AL. MARCA ATCC CATALOGO 6051 VIAL, MARCA ATCC, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "71", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "06.DETECCIÓN MOLECULAR Y ASESORÍA ANALÍTICA, TUBO CON PERLAS DE LISADO MAGNA LYSER GREEN BEADS MARCA ROCHE CATALOGO 3358941001 PIEZA (PAQUETE 100 PIEZAS), MARCA ROCHE, CADUCIDAD 12 MESES, 13 PIEZA", "requested_quantity": "13", "minimum_quantity": "13", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "72", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "06.DETECCIÓN MOLECULAR Y ASESORÍA ANALÍTICA, REALTIME READY RNA VIRUS MASTER MARCA ROCHE CATALOGO 5619416001 KIT 100 REACCIONES, MARCA ROCHE, CADUCIDAD 10 MESES, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "73", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "06.DETECCIÓN MOLECULAR Y ASESORÍA ANALÍTICA, FASTSTART TAQMAN® PROBE MASTER MARCA ROCHE CATALOGO 4673409001 KIT DE 100 REACCIONES., MARCA ROCHE , CADUCIDAD 10 MESES, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "74", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "06.DETECCIÓN MOLECULAR Y ASESORÍA ANALÍTICA, KIT PARA EXTRACCIÓN DE RNA MARCA ROCHE CATALOGO 11858882001 KIT, MARCA ROCHE, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "75", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "07.DICMALAB, NITROIMIDAZOLES Y AMINOGLUCOSIDOS EN MIEL (STREPTOMICINA Y DIHIDROESTREPTOMICINA) FRASCO DE 40 G, 02581 MARCA FAPAS CATALOGO FCVD14-HON2 FRASCO, MARCA FAPAS, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "76", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "07.DICMALAB, TETRACICLINAS EN MÚSCULO DE PESCADO FRASCO DE 20G, 02574 MARCA FAPAS CATALOGO FCVD22-SEA13 FRASCO, MARCA FAPAS, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "77", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "07.DICMALAB, TRANQUILIZANTES EN MÚSCULO DE CERDO FRASCO DE 20G, 02567 MARCA FAPAS CATALOGO FCVD32-MRP32 FRASCO, MARCA FAPAS, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "78", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "07.DICMALAB, AFLATOXINA M1 EN LECHE EN POLVO LITRO (FRASCO DE 55G, 04526 MARCA FAPAS CATALOGO FCMA1-DRY14 LITRO (FRASCO), MARCA FAPAS, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "79", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "08.HYGIENA MÉXICO, BAX SYSTEM PCR ASSAY REAL TIME SALMONELLA MARCA HYGIENA CATALOGO KIT2006/D14306040 PIEZA KIT 96 PRUEBAS, MARCA HYGIENA, CADUCIDAD 12 MESES, 42 LITRO", "requested_quantity": "42", "minimum_quantity": "42", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "80", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "08.HYGIENA MÉXICO, BAX REAL TIME PCR ASSAY STEC SCREENING STX Y EAE MARCA HYGIENA CATALOGO KIT2021/D14642964 KIT 96 REACCIONES, MARCA HYGIENA, CADUCIDAD 12 MESES, 12 LITRO", "requested_quantity": "12", "minimum_quantity": "12", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "81", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "08.HYGIENA MÉXICO, BAX SYSTEM PCR ASSAY REAL TIME L. MONOCYTOGENES MARCA HYGIENA CATALOGO KIT2005/D15134303 PIEZA KIT 96 PRUEBAS, MARCA HYGIENA, CADUCIDAD 12 MESES, 10 LITRO", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "82", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "08.HYGIENA MÉXICO, BAX PCR ASSAY REAL TIME STEC PANEL 2, 48 REACCIONES PCR BAX MARCA HYGIENA CATALOGO KIT2009/D14642987 KIT 48 REACCIONES, MARCA HYGIENA, CADUCIDAD 12 MESES, 10 LITRO", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "83", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "08.HYGIENA MÉXICO, BAX SYSTEM PCR ASSAY REAL TIME STEC PANEL 1, 48 REACCIONES PCR BAX®SYSTEM MARCA HYGIENA CATALOGO KIT2008/D14642970 KIT 48 REACCIONES, MARCA HYGIENA, CADUCIDAD 12 MESES, 10 LITRO", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "84", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "08.HYGIENA MÉXICO, BAX SYSTEM REAL TIME PCR ASSAY MARCA HYGIENA CATALOGO KIT2000 KIT 96 PRUEBAS, MARCA HYGIENA, CADUCIDAD 12 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "85", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "08.HYGIENA MÉXICO, CLUSTER BAX SYSTEM RACK DE 96 TUBOS MARCA HYGIENA CATALOGO MIS2012 PIEZA (PAQUETE 10 RACKS DE 96 TUBOS CADA RACK), MARCA HYGIENA, CADUCIDAD N/A, 4 PIEZA", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "86", "cucop_code": "25501-0057", "specific_item_code": "25501", "cucop_description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "description": "08.HYGIENA MÉXICO, CLUSTER TUBE CAPS-BAX SYSTEM-BAG OF 120 MARCA HYGIENA CATALOGO CAP2008 CAJA 120, MARCA HYGIENA, CADUCIDAD N/A, 10 PIEZA", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "87", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "09.MOTIBUS, KIT DE ELISA CLENBUTEROL MARCA RANDOX CATALOGO CB1418 KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 22 LITRO", "requested_quantity": "22", "minimum_quantity": "22", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "88", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "09.MOTIBUS, KIT 19 NORTESTOSTERONE MARCA RANDOX CATALOGO NT2105 KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 15 LITRO", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "89", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "09.MOTIBUS, KIT DE ELISA TETRACICLINAS MARCA RANDOX CATALOGO TCS10117-A/B KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 10 LITRO", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "90", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "09.MOTIBUS, KIT DE ELISA PARA DETERMINACION ETINILESTRADIOL MARCA RANDOX CATALOGO RLS9225 KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 8 LITRO", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "91", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "09.MOTIBUS, KIT DE ELISA PARA LA DETERMINACION TRENBOLONA MARCA RANDOX CATALOGO TB 2106 KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 8 LITRO", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "92", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "09.MOTIBUS, COLUMNA INMUNOAFINIDAD PARA PROMOTORES CRECIMIENTO BOLDENONA ZERANOL RACTOPAMINA Y CORTICOESTEROIDES EN ORINA Y TEJIDO MARCA RANDOX CATALOGO GP1821 PIEZA (CAJA 5 PIEZAS), MARCA RANDOX, CADUCIDAD N/A, 8 PIEZA", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "93", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "09.MOTIBUS, KIT DE ELISA PARA PHENYLBUTAZONE MARCA RANDOX CATALOGO PB3456 KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 6 LITRO", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "94", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "10.OMG INTERNATIONAL, KIT E. COLI O103 MARCA EUROFINS ABRAXIS CATALOGO 541020 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 5 LITRO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "95", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "10.OMG INTERNATIONAL, KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O26 MARCA EUROFINS ABRAXIS CATALOGO 541000 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 5 LITRO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "96", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "10.OMG INTERNATIONAL, KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O45 MARCA EUROFINS ABRAXIS CATALOGO 541010 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 5 LITRO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "97", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "10.OMG INTERNATIONAL, KIT E. COLI O111 MARCA EUROFINS ABRAXIS CATALOGO 541030 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "98", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "10.OMG INTERNATIONAL, KIT E. COLI O121 MARCA EUROFINS ABRAXIS CATALOGO 541040 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "99", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "10.OMG INTERNATIONAL, KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O145 MARCA EUROFINS ABRAXIS CATALOGO 541050 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "100", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "10.OMG INTERNATIONAL, PERLAS DE INMUNOSEPARACION PARA E. COLI O157:H7 MARCA EUROFINS ABRAXIS CATALOGO 543070 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "101", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "10.OMG INTERNATIONAL, KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O157:H7 MARCA EUROFINS ABRAXIS CATALOGO 541070 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "102", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "11.QUADRIX, KIT DE ELISA CLENBUTEROL MARCA R-BIOPHARM CATALOGO R1711 PIEZA KIT 96 PRUEBAS, MARCA R-BIOPHARM, CADUCIDAD 12 MESES, 42 LITRO", "requested_quantity": "42", "minimum_quantity": "42", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "103", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "11.QUADRIX, KIT DE ELISA PARA LA DETERMINACION AZAPERONE-AZAPEROL MARCA EUROPROXIMA CATALOGO 5201AZA KIT 96 PRUEBAS, MARCA EUROPROXIMA, CADUCIDAD 12 MESES, 15 LITRO", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "104", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "11.QUADRIX, KIT DE ELISA PARA LA DETERMINACIÓN CARAZOLOL MARCA EUROPROXIMA CATALOGO 5201CARA KIT 96 PRUEBAS, MARCA EUROPROXIMA, CADUCIDAD 12 MESES, 14 LITRO", "requested_quantity": "14", "minimum_quantity": "14", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "105", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "11.QUADRIX, KIT DE ELISA ESTREPTOMICINA MARCA R-BIOPHARM CATALOGO R3104 KIT 96 PRUEBAS, MARCA R-BIOPHARM, CADUCIDAD 12 MESES, 10 LITRO", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "106", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "11.QUADRIX, KIT DE ELISA PARA LA DETERMINACION ETINILESTRADIOL MARCA EUROPROXIMA CATALOGO 5081ESTR KIT 96 PRUEBAS, MARCA EUROPROXIMA, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "107", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "11.QUADRIX, CARTUCHOS DE EXTRACCIÓN RIDA C18 MARCA R-BIOPHARM CATALOGO R-2002 PIEZA (CAJA 100 PIEZAS), MARCA R-BIOPHARM, CADUCIDAD N/A, 6 PIEZA", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "108", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "11.QUADRIX, KIT DE HISTAMINA POR ELISAS MARCA RIDASCREEN CATALOGO R1605 KIT, MARCA RIDASCREEN, CADUCIDAD 12 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "109", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "11.QUADRIX, DECOLORANTE MUESTRAS MARCA R-BIOPHARM CATALOGO R1699 KIT 400 PRUEBAS, MARCA R-BIOPHARM, CADUCIDAD 12 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "110", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "12.UNIPARTS, MINICOLUMNS WIZARD SV GEL AND PCR CLEAN-UP SYSTEM MARCA PROMEGA CATALOGO A129B PIEZA (PAQUETE 250 PIEZAS), MARCA PROMEGA, CADUCIDAD 12 MESES, 43 PIEZA", "requested_quantity": "43", "minimum_quantity": "43", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "111", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "12.UNIPARTS, COLLECTION TUBES MARCA PROMEGA CATALOGO A130B PIEZA (PAQUETE 250 PIEZAS), MARCA PROMEGA, CADUCIDAD N/A, 30 PIEZA", "requested_quantity": "30", "minimum_quantity": "30", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "112", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "12.UNIPARTS, SOLUCIÓN MAESTRA PARA PCR 2X CONTIENE TODOS LOS REACTIVOS PARA LA REACCIÓN EXCEPTO INICIADORES Y ADN BLANCO PARA 1000 REACCIONES (PCR MASTER MIX) MARCA PROMEGA CATALOGO M7505 FRASCO 25 ML, MARCA PROMEGA, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "113", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "12.UNIPARTS, MINICOLUMNS WIZARD Y COLLECTION TUBES MARCA PROMEGA CATALOGO A1460 PIEZA (PAQUETE), MARCA PROMEGA, CADUCIDAD 12 MESES, 8 PIEZA", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "114", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "12.UNIPARTS, SISTEMA DE PURIFICACIÓN DE ADN GENÓMICO WIZARD SV MARCA PROMEGA CATALOGO A2361 CAJA (250 REACCIONES), MARCA PROMEGA, CADUCIDAD 12 MESES, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "115", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: IMNV P CCACCTTTACTTTCAATACTACATCATCCCCGG ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "116", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: PVNV P TTACGTCCCAGCGGTGCCAAATA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "117", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: YHV P CCATCAAAGCTCTCAACGCCGTCA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "118", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: SHRIMP P AGACTAATGATTATGCTACCTTCGCACGGT ESCALA: 1 µM DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: CY5/TAO/3’ IB RQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "119", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "12.UNIPARTS, PROTEINASA K MARCA PROMEGA CATALOGO A5051 FRASCO 23 ML, MARCA PROMEGA, CADUCIDAD 12 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "120", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SISTEMA COMERCIAL PARA LA PURIFICACIÓN A PARTIR DE SANGRE MARCA PROMEGA CATALOGO A5081 KIT, MARCA PROMEGA, CADUCIDAD 10 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "121", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, NPI-S /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ///56-FAM/TA CAT AGG C/ZEN/A AAA CCA AAG GAG ACA C/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y\nELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL. MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "122", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, GO TAQ LONG PCR MASTER MIX MARCA PROMEGA CATALOGO M4021 KIT 100 REACCIONES, MARCA PROMEGA, CADUCIDAD 10 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "123", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, RUM16S-P /// 1 µM AFFINITY PLUS® 5´ 6-FAM™ / 3´ IB®FQ /// HPLC /// 56-FAM/AG TTC AGC TTT AAA RA+T +A+C+C +AA/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "124", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, GBLOCKS GENE FRAGMENTS MARCA IDT CATALOGO GBLOCKS-1 KIT, MARCA IDT, CADUCIDAD N/A, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "125", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, 16S RRNA PROBE 5’ 5TYE665-GTG GGG TAA CGG CTC ACC TAG GCG AC-3IABRQSP 3’ MARCA IDT CATALOGO SINTESIS LITRO (PIEZA) , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "126", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, EAE PROBE 5’ 5MAXN-ATA GTC TCG CCA GTA TTC GCC ACC AAT ACC-IABKFQ 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "127", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: TILV-93S FAM/CTCTACCAGCTAGTGCCCCA/-IOWA BLACK ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO IDT-01 KIT, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "128", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: VHS-S: FAM/TACGCCATCATGATGAGT/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "129", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: AB P CAA CTC TTC GCA TGA GGT GGC CAA A ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "130", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: HPB S CCGCCCGTCAAGCCATGGAA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "131", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: IHNV-S TGAGACTGAGCGGGACA/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "132", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: MRNV RNA1 P: ACCCTTCGACCCCAGCAATGGTG ESCALA: 1 µM DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "133", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: OSHV P TGCCCCTGTCATCTTGAGGTATAGACAATC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "134", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SONDA: XSV P CATGCCCCATGATCCTCGCA ESCALA: 1 µM DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "135", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: RUM16S-RV: ACTTTTAAARMTACAGTGRRATTTATTT ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "136", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, STX1 PROBE 5’ 56-FAM-CTG GAT GAT/ZEN/CTC AGT GGG CGT TCT TAT GTA A-3IABKFQ 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "137", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, STX2 PROBE 5’ 56-FAM-TCG TCA GGC/ZEN/ACT GTC TGA AAC TGC TCC-3IABKFQ 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "138", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: SHRIMP R GTCCAACCATTCATACAAGCC ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "139", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: SHRIMP F AAGTCTAGCCTGCCCACTG ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "140", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, SISTEMA DE PURIFICACIÓN DE ADN WIZARD MARCA PROMEGA CATALOGO A1125 KIT 500 REACCIONES, MARCA PROMEGA, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "141", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "12.UNIPARTS, PROTEINASA K SOLUCIÓN MARCA PROMEGA CATALOGO MC5005 FRASCO 4ML, MARCA PROMEGA, CADUCIDAD 10 MESES, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "142", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: IMNV F GGACCTATCATACATAGCGTTTGCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "143", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: IMNV R AACCCATATCTATTGTCGCTGGAT ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "144", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: PVNV F TGGGAACGCTATAAGTGGTTATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "145", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: PVNV R ATCGTCGAGAGGATCAGTATCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "146", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: YHV R CCAGTGACGTTCGATGCAATA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "147", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: YHV F CGTCCCGGCAATTGTGATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "148", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MRNV-RNA1 R AGGAAATACACGAGCAAGAAAAGTC ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "149", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MR-18SRRNA R GTCCCGCATTGTTATTTTTCGTCA ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "150", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MRNV-RNA1 F CAACTCGGTATGGAACTCAAGGT ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "151", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MR-18SRRNA F CGCACCGGCTCCGTATCTTT ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "152", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: XSV F AGCCACACTCTCGCATCTGA ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "153", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: XSV R CTCCAGCAAAGTGCGATACG ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "154", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: RUM16S-FW: TGGTTGTCCAGAAGATG ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "155", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "12.UNIPARTS, WIZARD SV GEL MINICOLUMNS MARCA PROMEGA CATALOGO A9281 PIEZA (KIT PARA 50 REACCIONES), MARCA PROMEGA, CADUCIDAD 10 MESES, 2 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "156", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, NPI-FW /// 100 NMOLE DNA OLIGO /// HPLC /// GTT GAT MMA STA CAC CGG AG. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "157", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, NPI-RV /// 100 NMOLE DNA OLIGO /// HPLC /// AGG TCH CKT ATG AAG GAG TC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "158", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, STX F (FORWARD) 5’ TTT GTY ACT GTS ACA GCW GAA GCY TTA CG 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "159", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, EAE F (FORWARD) 5’ CAT TGA TCA GGA TTT TTC TGG TGA TA 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "160", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, STX R (REVERSE) 5’ CCC CAG TTC ARW GTR AGR TCM ACD TC 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "161", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: HPB R TTATCTTTTCTTTAAGGCGATGAGC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "162", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: PRIMERB GAA GGA ATG ATG CTA AAG CTG AAA C ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "163", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: PRIMER A CCA GCA TCA GAG TCT TTT CCA AAT ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "164", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: VHS-RV: TGTAGTAGGACTCTCCCAGCATCC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "165", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "12.UNIPARTS, BLUE ORANGE LOADING DYE 6X MARCA PROMEGA CATALOGO G1881 FRASCO 3 ML, MARCA PROMEGA, CADUCIDAD 12 MESES, 4 LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "166", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: OSHV F GTCGCATCTTTGGATTTAACAA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "167", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, 16SRNA-R (REVERSE) – 5’ GGC TGG TCA TCC TCT CAG ACC 3’ MARCA IDT CATALOGO SINTESIS LITRO (PIEZA) , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "168", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, EAER (REVERSE) 5’ CTC ATG CGG AAA TAG CCG TTM 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "169", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, MCR8_FW: 5’ TCA ACA ATT CTA CAA AGC GTG 3’ TAMAÑO 856 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "170", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, MCR6_FW: 5’ AGC TAT GTC AAT CCC GTG AT 3’ TAMAÑO 252 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "171", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPA GATCTGCAAGAGGACAAACC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "172", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPB ATCGCTAAGCTCTGGCATCC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "173", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPD TGTTCTCAGCCAATACATCG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "174", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPE TACATCTTGGATGCCTCTGC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "175", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPF TACCCTGCATTCCTTGTCGC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "176", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPG ATCCTGTTTCCAAGCTCTGC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "177", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: HPB F CGTTCACGGGCCTTGTACAC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "178", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MRNV-2 F GATGACCCCAACGTTATCCT ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "179", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MRNV-2 R GTGTAGTCACTTGCAAGAGG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "180", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: OSHV R ACTGGGATCCGACTGACAAC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "181", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, 16SRNA-F (FORWARD) – 5’ CCT CTT GCC ATC GGA TGT G 3’ MARCA IDT CATALOGO SINTESIS LITRO (PIEZA) , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "182", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, MCR6_REV: 5’ ATT GGC TAG GTT GTC AAT C 3’ TAMAÑO 252 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "183", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: IHNV-FW: AGAGCCAAGGCACTGTGCG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "184", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: IHNV-RV: TTCTTTGCGGCTTGGTTGA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "185", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: VHS-FW: ATGAGGCAGGTGTCGGAGG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "186", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, MCR7_FW: 5’ GCC CTT CTT TTC GTT GTT 3’ TAMAÑO 551 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "187", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, MCR7_REV: 5’ GGT TGG TCT CTT TCT CGT 3’ TAMAÑO 551 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "188", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, MCR8_REV: 5’ AAT GCT GCG CGA ATG AAG 3’ TAMAÑO 856 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "189", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, MCR9_FW: 5’ TTC CCT TTG TTC TGG TTG 3’ TAMAÑO 1011 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "190", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, MCR9_REV: GCA GGT AAT AAG TCG GTC TAMAÑO 1011 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "191", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BP-6581 TGTAGCAGCAGAGAAGAG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "192", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BP-6582 CACTAAGCCTATCTCCAG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "193", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: TILV-93R: CTGCTTGAGTTGTGCTTCT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "194", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: TILV-93F: AGCCTGCCACACAGAAG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "195", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "12.UNIPARTS, AGUA LIBRE DE NUCLEASAS MARCA PROMEGA CATALOGO P1193 LITRO (FRASCO 50 ML), MARCA PROMEGA, CADUCIDAD 10 MESES, 1 LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "196", "cucop_code": "25501-0061", "specific_item_code": "25501", "cucop_description": "ACRODISCOS", "description": "13.WATERS, ACRODISCOS PTFE DE 13MM, 0.2µM.CON PUNTA MINISPIKE MARCA WATERS CATALOGO WAT200824 PIEZA (PAQUETE 1000 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 8 PIEZA", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "197", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "13.WATERS, CARTUCHOS DE EXTRACCIÓN DE FASE SÓLIDA OASIS HLB 6 CC (200 MG) MARCA WATERS CATALOGO WAT106202 PIEZA (CAJA 30 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 60 PIEZA", "requested_quantity": "60", "minimum_quantity": "60", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "198", "cucop_code": "25501-0061", "specific_item_code": "25501", "cucop_description": "ACRODISCOS", "description": "13.WATERS, ACRODISCOS PTFE 0,45µM X 4MM MARCA WATERS CATALOGO WAT200508 PIEZA (PAQUETE 250 PIEZA), MARCA WATERS, CADUCIDAD N/A, 15 PIEZA", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "199", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "13.WATERS, CARTUCHOS DE ALUMINA B SEP-PAK CLASSIC MARCA WATERS CATALOGO WAT051820 PIEZA (CAJA 50 PIEZA), MARCA WATERS, CADUCIDAD N/A, 15 PIEZA", "requested_quantity": "15", "minimum_quantity": "15", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "200", "cucop_code": "25501-0083", "specific_item_code": "25501", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "description": "13.WATERS, SEPTA PREHORADADAS PTFE DE SILICÓN DE PS 8 MILÍMETROS MARCA WATERS CATALOGO WAT058876 PIEZA (PAQUETE 100 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 80 PIEZA", "requested_quantity": "80", "minimum_quantity": "80", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "201", "cucop_code": "25501-0082", "specific_item_code": "25501", "cucop_description": "FILTROS", "description": "13.WATERS, CARTUCHOS DE EXTRACCIÓN DE SILICA SEP-PAK VAC 6 CC (1G) MARCA WATERS CATALOGO WAT036910 PIEZA (PAQUETE 30 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 20 PIEZA", "requested_quantity": "20", "minimum_quantity": "20", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "202", "cucop_code": "25501-0087", "specific_item_code": "25501", "cucop_description": "ELECTRODO DE REFERENCIA", "description": "13.WATERS, CONE GAS NOZZLE (# 700004216)/XEVO MARCA WATERS CATALOGO 700004216 PIEZA, MARCA WATERS, CADUCIDAD N/A, 6 PIEZA", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "203", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "13.WATERS, COLUMNA HSST3 1.8µM 2.1X100MM MARCA WATERS CATALOGO 186003539 PIEZA, MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "204", "cucop_code": "25501-0122", "specific_item_code": "25501", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "description": "13.WATERS, SAMPLE NEEDLE KIT, 15µL, SS (# 700008977) MARCA WATERS CATALOGO 700008977 PIEZA, MARCA WATERS, CADUCIDAD 12 MESES, 3 PIEZA", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "205", "cucop_code": "25501-0122", "specific_item_code": "25501", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "description": "13.WATERS, ACTIVE PREHEATER (# 205000894) MARCA WATERS CATALOGO 205000894 PIEZA, MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "206", "cucop_code": "25501-0122", "specific_item_code": "25501", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "description": "13.WATERS, SAMPLE CONE (CONO DE MUESTRA XEVO TQ/MS) MARCA WATERS CATALOGO 700004219 PIEZA , MARCA WATERS, CADUCIDAD 12 MESES, 5 PIEZA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "207", "cucop_code": "25501-0122", "specific_item_code": "25501", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "description": "13.WATERS, SAMPLE CONE MARCA WATERS CATALOGO 700011217 PIEZA, MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "208", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "13.WATERS, ACQUITY UPLC BEH SHIELD RP18 1.7 µM, 2.1 MM X 100 MM.COLUMN MARCA WATERS CATALOGO 186002854 PIEZA, MARCA WATERS, CADUCIDAD N/A, 1 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "209", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "13.WATERS, ACQUITY UPLC HSS PFP COLUMN, 100Å, 1.8 µM, 2.1 MM X 100 MM, 1/PKG MARCA WATERS CATALOGO 1860005967 PIEZA, MARCA WATERS, CADUCIDAD N/A, 1 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "210", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "13.WATERS, ACQUITY UPLC BEH SHIELD RP18 VANGUARD PRE-COLUMN 130Å 1.7 µM 2.1 MM X 5 MM MARCA WATERS CATALOGO 186003977 PIEZA (PAQUETE 3 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 1 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "211", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "13.WATERS, PIC A REAGENT MARCA WATERS CATALOGO WAT085101 PAQUETE 5 PIEZA, MARCA WATERS, CADUCIDAD 12 MESES, 3 LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "212", "cucop_code": "25501-0058", "specific_item_code": "25501", "cucop_description": "BASE SOPORTE DE MATRACES", "description": "13.WATERS, 96-WELL SAMPLE COLLECTION PLATE, 800 µL ROUND WELL MARCA WATERS CATALOGO 186002481 PIEZA (CAJA 50 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "213", "cucop_code": "25501-0083", "specific_item_code": "25501", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "description": "13.WATERS, LCMS CERTIFIED CLEAR GLASS 12 X 32MM SCREW NECK VIAL, WITH CAP AND PRESLIT PTFE/SILICONE SEPTA, 2 ML MARCA WATERS CATALOGO 600000668CV PIEZA (PAQUETE 100 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 6 PIEZA", "requested_quantity": "6", "minimum_quantity": "6", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "214", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "13.WATERS, SEAT PORT ASSEMBLY, .003 ID (# 700006056) MARCA WATERS CATALOGO 700006056 PIEZA, MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "215", "cucop_code": "25501-0083", "specific_item_code": "25501", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "description": "13.WATERS, LCMS CERTIFIED AMBER GLASS 12 X 32MM SCREW NECK VIAL, WITH CAP AND PRESLIT PTFE/SILICONE SEPTA, 2 ML MARCA WATERS CATALOGO 600000669CV PIEZA (PAQUETE 100 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 5 PIEZA", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "216", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "13.WATERS, VIAL DE VIDRIO DE 12 X 32 CON TAPA Y SEPTA ALTO RECOBRO MARCA WATERS CATALOGO 600000750CV PIEZA (CAJA 100 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "217", "cucop_code": "25501-0077", "specific_item_code": "25501", "cucop_description": "FRASCO", "description": "13.WATERS, VIAL HOLDER, 48-WELL, 2ML VIAL MARCA WATERS CATALOGO 700011047 PIEZA, MARCA WATERS, CADUCIDAD N/A, 8 PIEZA", "requested_quantity": "8", "minimum_quantity": "8", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "218", "cucop_code": "25501-0057", "specific_item_code": "25501", "cucop_description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "description": "13.WATERS, TAPA CON SEPTA DE SILICONA/PTFE COLOR VERDE PARA VIAL DE 12 X 32MM MARCA WATERS CATALOGO 186002130 PIEZA (PAQUETE 100 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "219", "cucop_code": "25501-0122", "specific_item_code": "25501", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "description": "13.WATERS, HANDLE CONE GAS NOZZLE (XEVO SUJETADOR) MARCA WATERS CATALOGO 700010292 PIEZA, MARCA WATERS, CADUCIDAD N/A, 1 PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "220", "cucop_code": "25501-0008", "specific_item_code": "25501", "cucop_description": "CONO REVESTIMIENTO", "description": "13.WATERS, O-RING VITON 10 I/D X 1.5 C/S (CONO XEVO) MARCA WATERS CATALOGO 700004321 PIEZA, MARCA WATERS, CADUCIDAD N/A, 10 PIEZA", "requested_quantity": "10", "minimum_quantity": "10", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] } ], "budget_items": [ { "code": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "code": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "awards": [ { "id": "C-2024-00047584", "internal_reference": "A-010/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "normalized_name": "AGILENT TECHNOLOGIES MEXICO", "rfc_type": null, "slug": "agilent-technologies-mexico" }, "contract_period": { "published_at": "2024-04-25T22:50:23.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-09-30T06:00:00.000Z" }, "value": { "subtotal": "1103107.31", "tax": "176497.17", "total": "1279604.48", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, QUECHERS EXTRACTION PACKETS, AOAC MARCA AGILENT CATALOGO 5982-7755 PIEZA (PAQUETE 200 PIEZAS), MARCA AGILENT, CADUCIDAD 12 MESES, 15 PIEZA", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "14661.66", "subtotal": "219924.9", "tax": "35187.98", "other_taxes": null, "total": "255112.88", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0048", "description": "01.AGILENT TECHNOLOGIES MÉXICO, BOND ELUT  CERTIFY, 500 MG, 6 ML MARCA AGILENT CATALOGO 12102093 PIEZA (PAQUETE 30 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 60 PIEZA", "unit": "PIEZA", "requested_quantity": "60", "awarded_quantity": null, "unit_price": "3351.73", "subtotal": "201103.8", "tax": "32176.61", "other_taxes": null, "total": "233280.41", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, INSERTO DE VIDRIO DE 400 MICROLITROS MARCA AGILENT CATALOGO 5181-3377 PIEZA (PAQUETE 500 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 100 PIEZA", "unit": "PIEZA", "requested_quantity": "100", "awarded_quantity": null, "unit_price": "1665.38", "subtotal": "166538", "tax": "26646.08", "other_taxes": null, "total": "193184.08", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, CARTUCHOS DE EXTRACCIÓN BOND-ELUT MEGA BE-C18, 1GM 6ML MARCA AGILENT CATALOGO 12256001 PIEZA (CAJA 30 PIEZA), MARCA AGILENT, CADUCIDAD N/A, 40 PIEZA", "unit": "PIEZA", "requested_quantity": "40", "awarded_quantity": null, "unit_price": "3437.67", "subtotal": "137506.8", "tax": "22001.09", "other_taxes": null, "total": "159507.89", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, SPE DISPERSIVA 15ML, GRASA/PIGMENT, AOAC MARCA AGILENT CATALOGO 5982-5456 PIEZA (PAQUETE 50 PIEZAS), MARCA AGILENT, CADUCIDAD 12 MESES, 15 PIEZA", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "7167.54", "subtotal": "107513.1", "tax": "17202.1", "other_taxes": null, "total": "124715.2", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, CARTUCHOS DE EXTRACCIÓN BOND ELUT-SAX 500MG/ 3ML MARCA AGILENT CATALOGO 12102044 PIEZA (CAJA 50 CARTUCHOS), MARCA AGILENT, CADUCIDAD N/A, 10 PIEZA", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "5156.51", "subtotal": "51565.1", "tax": "8250.42", "other_taxes": null, "total": "59815.52", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0007", "description": "01.AGILENT TECHNOLOGIES MÉXICO, DB5-MS 30 MTS LENGTH; 0,250 MM NARROWBORE; FILM 0,25 MICROMETROS, LIMITES DE TEMPERATURA -60 A 325 °C (350 °C) MARCA AGILENT CATALOGO 122-5532 PIEZA, MARCA AGILENT, CADUCIDAD N/A, 2 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "15108.56", "subtotal": "30217.12", "tax": "4834.74", "other_taxes": null, "total": "35051.86", "cucop_description": "CARGADOR DE DOSIMETROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, CARTUCHOS DE EXTRACCIÓN BOND ELUT-SCX 500MG/3ML MARCA AGILENT CATALOGO 12102040 PIEZA (CAJA 50 CARTUCHOS), MARCA AGILENT, CADUCIDAD N/A, 4 PIEZA", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "5156.51", "subtotal": "20626.04", "tax": "3300.17", "other_taxes": null, "total": "23926.21", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "01.AGILENT TECHNOLOGIES MÉXICO, VIAL DE VIDRIO TRANSPARENTE DE 2 ML CON TAPON DE ROSCA AZUL Y SEPTA PTFE/GOMA DE SILICONA ROJA PARA AUTOMUESTREADOR MARCA AGILENT CATALOGO 5182-0553 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 15 PIEZA", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "1315.42", "subtotal": "19731.3", "tax": "3157.01", "other_taxes": null, "total": "22888.31", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, QUECHERS EXTRACTION SALT PACKETS EN METHOD MARCA AGILENT CATALOGO 5982-6650 PIEZA (PAQUETE 50 PIEZAS), MARCA AGILENT, CADUCIDAD 12 MESES, 5 PIEZA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "3815.81", "subtotal": "19079.05", "tax": "3052.65", "other_taxes": null, "total": "22131.7", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, CARTUCHOS DE EXTRACCIÓN C2 500MG /3ML MARCA AGILENT CATALOGO 12102030 PIEZA (CAJA 50 PIEZA), MARCA AGILENT, CADUCIDAD N/A, 5 PIEZA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "3729.87", "subtotal": "18649.35", "tax": "2983.9", "other_taxes": null, "total": "21633.25", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0067", "description": "01.AGILENT TECHNOLOGIES MÉXICO, HOMOGENIZADORES CERAMICOS TUBOS 50 ML MARCA AGILENT CATALOGO 5982-9313 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 15 PIEZA", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "1178.43", "subtotal": "17676.45", "tax": "2828.23", "other_taxes": null, "total": "20504.68", "cucop_description": "MARCADOR DE PESO MOLECULAR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, QUECHERS DISPERSIVE SPE 15 ML FRUITS AND VEGETABLES AOAC METHOD MARCA AGILENT CATALOGO 5982-5058 PIEZA (CAJA 50 PIEZAS), MARCA AGILENT, CADUCIDAD 12 MESES, 5 PIEZA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "3214.22", "subtotal": "16071.1", "tax": "2571.38", "other_taxes": null, "total": "18642.48", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "01.AGILENT TECHNOLOGIES MÉXICO, COLUMNA ZORBAX ECLIPSE PAH (4.6 X 50 MM, 1.8 µM) MARCA AGILENT CATALOGO 959941-918 PIEZA, MARCA AGILENT, CADUCIDAD N/A, 1 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13063.15", "subtotal": "13063.15", "tax": "2090.1", "other_taxes": null, "total": "15153.25", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, INSERTO CÓNICO 300 µL 5.6X30MM CON PIÉ DE POLIPROPILENO MARCA AGILENT CATALOGO 5182-0549 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 20 PIEZA", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "621.19", "subtotal": "12423.8", "tax": "1987.81", "other_taxes": null, "total": "14411.61", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "01.AGILENT TECHNOLOGIES MÉXICO, COLUMNA CROMATOGRAFICA ZORBAX ECLIPSE PLUS C18, RAPID RESOLUTION, 4.6 X 100 MM, 3.5 MICRAS MARCA AGILENT CATALOGO 959961-902 PIEZA, MARCA AGILENT, CADUCIDAD N/A, 1 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12306.86", "subtotal": "12306.86", "tax": "1969.1", "other_taxes": null, "total": "14275.96", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "01.AGILENT TECHNOLOGIES MÉXICO, VIAL DE VIDRIO COLOR AMBAR CON TAPÓN CERRADO DE 22ML MARCA AGILENT CATALOGO 5183-4323 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 5 PIEZA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "2200.11", "subtotal": "11000.55", "tax": "1760.09", "other_taxes": null, "total": "12760.64", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0083", "description": "01.AGILENT TECHNOLOGIES MÉXICO, FERRULE PARA CROMATÓGRAFO DE GASES GC/MS, 0,25 MM DE DI, 1/16 PULG. X 0,40 MM, 10/PAQ. MARCA AGILENT CATALOGO 5062-3508 PIEZA (PAQUETE 10 PIEZA), MARCA AGILENT, CADUCIDAD N/A, 6 PIEZA", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1753.21", "subtotal": "10519.26", "tax": "1683.08", "other_taxes": null, "total": "12202.34", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "01.AGILENT TECHNOLOGIES MÉXICO, VIAL DE VIDRIO AMBAR CON TAPON DE ROSCA VERDE Y SEPTA PTFE/GOMA SILICONA ROJA MARCA AGILENT CATALOGO 5182-0554 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 6 PIEZA", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1188.92", "subtotal": "7133.52", "tax": "1141.36", "other_taxes": null, "total": "8274.88", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "01.AGILENT TECHNOLOGIES MÉXICO, FC43 O PFTBA MARCA AGILENT CATALOGO 05971-60571 AMPOLLETA, MARCA AGILENT, CADUCIDAD 12 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2578.25", "subtotal": "5156.5", "tax": "825.04", "other_taxes": null, "total": "5981.54", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0082", "description": "01.AGILENT TECHNOLOGIES MÉXICO, INSERTO VIAL DE 100 UL MARCA AGILENT CATALOGO 5183-2085 PIEZA (PAQUETE 100 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 4 PIEZA", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1032.5", "subtotal": "4130", "tax": "660.8", "other_taxes": null, "total": "4790.8", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0048", "description": "01.AGILENT TECHNOLOGIES MÉXICO, TUBO DE BOMBA PERISTÁLTICA, PVC, AZUL/ AZUL PUENTEADOS CON PESTAÑAS PARA MUESTRAS DE AGUA MARCA AGILENT CATALOGO 3710034600 PIEZA (BOLSA 12 PIEZAS), MARCA AGILENT, CADUCIDAD N/A, 1 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1171.56", "subtotal": "1171.56", "tax": "187.43", "other_taxes": null, "total": "1358.99", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2024-00047598", "internal_reference": "A-011/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "ANALITEK SA DE CV", "normalized_name": "ANALITEK", "rfc_type": null, "slug": "analitek" }, "contract_period": { "published_at": "2024-04-25T22:50:04.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-09-30T06:00:00.000Z" }, "value": { "subtotal": "360198", "tax": "57631.68", "total": "417829.68", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "02.ANALITEK, NEXTERA® XT DNA SAMPLE PREPARATION KIT MARCA ILLUMINA CATALOGO FC-131-1096 KIT, MARCA ILLUMINA, CADUCIDAD 10 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "69129", "subtotal": "138258", "tax": "22121.28", "other_taxes": null, "total": "160379.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "02.ANALITEK, MISEQ REAGENT KIT V3 (600-CYCLE) MARCA ILLUMINA CATALOGO MS-102-3003 KIT, MARCA ILLUMINA, CADUCIDAD 6 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "52768", "subtotal": "105536", "tax": "16885.76", "other_taxes": null, "total": "122421.76", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "02.ANALITEK, MISEQ REAGENT KIT V2 (500-CYCLES) MARCA ILLUMINA CATALOGO MS-102-2003 KIT, MARCA ILLUMINA, CADUCIDAD 6 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "40542", "subtotal": "81084", "tax": "12973.44", "other_taxes": null, "total": "94057.44", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "02.ANALITEK, MISEQ REAGENT NANO KIT V2 (500- CYCLES) MARCA ILLUMINA CATALOGO MS-103-1003 KIT, MARCA ILLUMINA, CADUCIDAD 6 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "12075", "subtotal": "24150", "tax": "3864", "other_taxes": null, "total": "28014", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "02.ANALITEK, PHIX CONTROL V3 MARCA ILLUMINA CATALOGO FC-110-3001 KIT, MARCA ILLUMINA, CADUCIDAD 10 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5585", "subtotal": "11170", "tax": "1787.2", "other_taxes": null, "total": "12957.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2024-00047605", "internal_reference": "A-012/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "normalized_name": "APPLIED BIOSYSTEMS DE MEXICO", "rfc_type": null, "slug": "applied-biosystems-de-mexico" }, "contract_period": { "published_at": "2024-04-25T22:49:50.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-09-30T06:00:00.000Z" }, "value": { "subtotal": "1041632.03", "tax": "166661.12", "total": "1208293.15", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, MEZCLA MAESTRA EN UN SOLO PASO EN FORMATO TAQMAN PARA DETECCION DE VIRUS EN FORMATO FAST MARCA APPLIED BIOSYSTEMS CATALOGO 4444436 TUBO 10 ML, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 12 MESES, 7 LITRO", "unit": "LITRO", "requested_quantity": "7", "awarded_quantity": null, "unit_price": "69036.88", "subtotal": "483258.19", "tax": "77321.31", "other_taxes": null, "total": "560579.5", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0048", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, TUBO CÓNICOS PARA CENTRÍFUGA FALCON™ DE 15ML MARCA THERMO FISHER SCIENTIFIC CATALOGO 339651 PIEZA (PAQUETE 500 PIEZAS), MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD N/A, 30 PIEZA", "unit": "PIEZA", "requested_quantity": "30", "awarded_quantity": null, "unit_price": "4271.63", "subtotal": "128148.9", "tax": "20503.82", "other_taxes": null, "total": "148652.72", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, MEZCLA MAESTRA PARA SISTEMAS TAQMAN EN FORMATO FAST ADVANCED MARCA APPLIED BIOSYSTEMS CATALOGO 4444963 PAQUETE 2 UNIDADES DE 5ML, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 12 MESES, 6 LITRO", "unit": "LITRO", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "17796.24", "subtotal": "106777.44", "tax": "17084.39", "other_taxes": null, "total": "123861.83", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, BUFFER DE SECUENCIACIÓN & TF, BDT V3.1 RR-100 MARCA APPLIED BIOSYSTEMS CATALOGO 4337455 KIT 100 REACCIONES, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 10 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "27922.37", "subtotal": "55844.74", "tax": "8935.16", "other_taxes": null, "total": "64779.9", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, AGAROSA ULTRAPURA MARCA INVITROGEN CATALOGO 16500-500 LITRO (FRASCO 500 G), MARCA INVITROGEN, CADUCIDAD 12 MESES, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "14023.51", "subtotal": "42070.53", "tax": "6731.28", "other_taxes": null, "total": "48801.81", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, MEZCLA MAESTRA AGPATH-ID™ ONE-STEP RT-PCR REAGENTS MARCA THERMO SCIENTIFIC APPLIED BIOSYSTEM CATALOGO 4387391 PIEZA, MARCA THERMO FISHER SCIENTIFIC , CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "40724.34", "subtotal": "40724.34", "tax": "6515.89", "other_taxes": null, "total": "47240.23", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0071", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, PLACA DE 96 POZOS PARA MICROAMPLIFICACION MARCA APPLIED BIOSYSTEMS CATALOGO 4346906 PIEZA (CAJA 20 PIEZAS), MARCA APPLIED BIOSYSTEMS, CADUCIDAD N/A, 20 PIEZA", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "1624.57", "subtotal": "32491.4", "tax": "5198.62", "other_taxes": null, "total": "37690.02", "cucop_description": "PLACA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, GENERULER 100 BP DNA LADDER MARCA THERMO FISHER SCIENTIFIC CATALOGO SM0322  PAQUETE 5 PIEZA, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 12 MESES, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "6204.6", "subtotal": "18613.8", "tax": "2978.21", "other_taxes": null, "total": "21592.01", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0103", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, FG-CUBIERTAS ADHESIVAS OPTICAS MARCA APPLIED BIOSYSTEMS CATALOGO 4311971 PIEZA (PAQUETE 100 PIEZAS), MARCA APPLIED BIOSYSTEMS, CADUCIDAD 12 MESES, 4 PIEZA", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "4138.13", "subtotal": "16552.52", "tax": "2648.4", "other_taxes": null, "total": "19200.92", "cucop_description": "PAPEL PARAFILM", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, PASTILLAS DE AGROSA TOPVISIÓN MARCA THERMO FISHER SCIENTIFIC CATALOGO R2802 CAJA 1000 TABLETAS, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "12943.74", "subtotal": "12943.74", "tax": "2071.01", "other_taxes": null, "total": "15014.75", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, POLIMERO POP 7 MARCA APPLIED BIOSYSTEMS CATALOGO 4393708 PIEZA, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 10 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5328.65", "subtotal": "10657.3", "tax": "1705.17", "other_taxes": null, "total": "12362.47", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, MEZCLA MAESTRA DREAMTAQ GREEN PCR (2X) MARCA THERMO FISHER SCIENTIFIC CATALOGO K1081 TUBO, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2577.01", "subtotal": "10308.04", "tax": "1649.29", "other_taxes": null, "total": "11957.33", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, PV-1 PERFORMANCE VERIFICATION SOLUTION MARCA THERMO FISHER SCIENTIFIC CATALOGO CHEM-PV-1 AMPOLLETA 0.5 ML, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 12 MESES, 5 LITRO", "unit": "LITRO", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1993.89", "subtotal": "9969.45", "tax": "1595.11", "other_taxes": null, "total": "11564.56", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, ENZIMA DE RESTRICCIÓN MBOI RECONOCE Y CORTA LA SECUENCIA GATC MARCA INVITROGEN CATALOGO IVGN0554 PIEZA, MARCA INVITROGEN, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2372.21", "subtotal": "9488.84", "tax": "1518.21", "other_taxes": null, "total": "11007.05", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, ENZIMA DE RESTRICCIÓN ANZA 44 ALUI MARCA INVITROGEN CATALOGO IVGN0446 PIEZA, MARCA INVITROGEN, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2169.92", "subtotal": "8679.68", "tax": "1388.75", "other_taxes": null, "total": "10068.43", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, ENZIMA DE RESTRICCIÓN ANZA 42 RSAI MARCA INVITROGEN CATALOGO IVGN0426 PIEZA, MARCA INVITROGEN, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "2041.2", "subtotal": "8164.8", "tax": "1306.37", "other_taxes": null, "total": "9471.17", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, QUBIT DSDNA HS ASSAY KIT MARCA THERMO FISHER SCIENTIFIC CATALOGO Q32854 PIEZA KIT 500 REACCIONES, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7317.21", "subtotal": "7317.21", "tax": "1170.75", "other_taxes": null, "total": "8487.96", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, KIT ACONDICIONADOR NANODROP™ PR-1 MARCA THERMO FISHER SCIENTIFIC CATALOGO CHEM-PR1-KIT KIT, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 10 MESES, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2294.86", "subtotal": "6884.58", "tax": "1101.53", "other_taxes": null, "total": "7986.11", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, ESTÁNDAR DE ADN DE 100 BP MARCA INVITROGEN CATALOGO 15628050 TUBO 250 µG, MARCA INVITROGEN, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "6651.69", "subtotal": "6651.69", "tax": "1064.27", "other_taxes": null, "total": "7715.96", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, AGUA LIBRE DE NUCLEASAS DEPC MARCA INVITROGEN CATALOGO AM9922 LITRO (FRASCO 1 L), MARCA INVITROGEN, CADUCIDAD 10 MESES, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "2053.97", "subtotal": "6161.91", "tax": "985.91", "other_taxes": null, "total": "7147.82", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, LÍQUIDO DE CALIBRACIÓN NANODROP™ CF-1 MARCA THERMO FISHER SCIENTIFIC CATALOGO CHEM-CF-1 AMPOLLETA 0.5 ML, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 10 MESES, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "1993.89", "subtotal": "5981.67", "tax": "957.07", "other_taxes": null, "total": "6938.74", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, TBE 10 X GRADO BIOLOGIA MOLECULAR MARCA INVITROGEN CATALOGO 15581044 FRASCO 1 L, MARCA INVITROGEN, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "1250.75", "subtotal": "5003", "tax": "800.48", "other_taxes": null, "total": "5803.48", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, SOLUCIÓN DE LISOZIMA DE 50MG/ML MARCA THERMO FISHER SCIENTIFIC CATALOGO 90082 VIAL 0.5ML, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 10 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1420.18", "subtotal": "2840.36", "tax": "454.46", "other_taxes": null, "total": "3294.82", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, REACTIVO DE ACONDICIONAMIENTO PARA 3,500-SEQSTUDIO MARCA APPLIED BIOSYSTEMS CATALOGO 4393718 PIEZA, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 10 MESES, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "797.05", "subtotal": "2391.15", "tax": "382.58", "other_taxes": null, "total": "2773.73", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, DNA GEL LOADING DYE (6X) MARCA THERMO FISHER SCIENTIFIC CATALOGO R0611 PAQUETE 5 PIEZA, MARCA THERMO FISHER SCIENTIFIC, CADUCIDAD 10 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "946.55", "subtotal": "1893.1", "tax": "302.9", "other_taxes": null, "total": "2196", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "03.APPLIED BIOSYSTEMS DE MEXICO, HI-DI FORMAMIDA MARCA APPLIED BIOSYSTEMS CATALOGO 4440753 KIT 5 ML, MARCA APPLIED BIOSYSTEMS, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1813.65", "subtotal": "1813.65", "tax": "290.18", "other_taxes": null, "total": "2103.83", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2024-00047610", "internal_reference": "A-013/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "BIOMERIEUX MEXICO SA DE CV", "normalized_name": "BIOMERIEUX MEXICO", "rfc_type": null, "slug": "biomerieux-mexico" }, "contract_period": { "published_at": "2024-04-25T22:49:21.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-09-30T06:00:00.000Z" }, "value": { "subtotal": "115753", "tax": "18520.48", "total": "134273.48", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "04.BIOMERIUX, API 20E ENTEROBACTERIAS MARCA BIOMERIEUX CATALOGO 20100 KIT , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 11 LITRO", "unit": "LITRO", "requested_quantity": "11", "awarded_quantity": null, "unit_price": "4283", "subtotal": "47113", "tax": "7538.08", "other_taxes": null, "total": "54651.08", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "04.BIOMERIUX, API LISTERIA MARCA BIOMERIEUX CATALOGO 10300 CAJA 25 PIEZA, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "6235", "subtotal": "24940", "tax": "3990.4", "other_taxes": null, "total": "28930.4", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "04.BIOMERIUX, API 50 CH MARCA BIOMERIEUX CATALOGO OT-50300 CAJA 10 TIRAS, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10016", "subtotal": "10016", "tax": "1602.56", "other_taxes": null, "total": "11618.56", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "04.BIOMERIUX, API® 20 A IDENTIFICACIÓN DE BACTERIAS ANAEROBIAS EN 24-48 HORA MARCA BIOMERIEUX CATALOGO 20300 CAJA 25 GALERÍAS , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8364", "subtotal": "8364", "tax": "1338.24", "other_taxes": null, "total": "9702.24", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "04.BIOMERIUX, API 20 STREP MARCA BIOMERIEUX CATALOGO 20600 CAJA 25 GALERÍAS , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7776", "subtotal": "7776", "tax": "1244.16", "other_taxes": null, "total": "9020.16", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "04.BIOMERIUX, API ESTAFILOCOCOS MARCA BIOMERIEUX CATALOGO 20500 CAJA 25 GALERÍAS , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "7407", "subtotal": "7407", "tax": "1185.12", "other_taxes": null, "total": "8592.12", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "04.BIOMERIUX, API 20E REAGENTS MARCA BIOMERIEUX CATALOGO 20120 KIT , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2473", "subtotal": "4946", "tax": "791.36", "other_taxes": null, "total": "5737.36", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "04.BIOMERIUX, API 50 CHB/E MEDIUM MARCA BIOMERIEUX CATALOGO OT-50430 CAJA C/10 AMPOLLETAS DE 10ML , MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2207", "subtotal": "2207", "tax": "353.12", "other_taxes": null, "total": "2560.12", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "04.BIOMERIUX, ZYM A X 2 MARCA BIOMERIEUX CATALOGO 70494 2 AMPOLLETA DE 5ML, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "972", "subtotal": "972", "tax": "155.52", "other_taxes": null, "total": "1127.52", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "04.BIOMERIUX, REACTIVO NIN X 2 (NINHIDRINA) MARCA BIOMERIEUX CATALOGO 70491 2 AMPOLLETA DE 5ML, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "792", "subtotal": "792", "tax": "126.72", "other_taxes": null, "total": "918.72", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "04.BIOMERIUX, XYL (XILENO) MARCA BIOMERIEUX CATALOGO 70530 2 AMPOLLETA DE 5ML, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "772", "subtotal": "772", "tax": "123.52", "other_taxes": null, "total": "895.52", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "04.BIOMERIUX, BCP (PÚRPURA BROMOCRESOL) MARCA BIOMERIEUX CATALOGO 70510 AMPOLLETA 5 ML, MARCA BIOMERIEUX, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "448", "subtotal": "448", "tax": "71.68", "other_taxes": null, "total": "519.68", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2024-00047614", "internal_reference": "A-014/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "CIENTIFICA SENNA SA DE CV", "normalized_name": "CIENTIFICA SENNA", "rfc_type": null, "slug": "cientifica-senna" }, "contract_period": { "published_at": "2024-04-25T22:48:15.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "61749.18", "tax": "9879.87", "total": "71629.05", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "05.CIENTÍFICA SENNA, CAMPYLOBACTER COLY MARCA ATCC CATALOGO 33559 VIAL, MARCA ATCC, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "24035.5", "subtotal": "24035.5", "tax": "3845.69", "other_taxes": null, "total": "27881.19", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "05.CIENTÍFICA SENNA, SALMONELLA ABAETETUBA ENTERICA MARCA ATCC CATALOGO 35640 VIAL, MARCA ATCC, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "24035.5", "subtotal": "24035.5", "tax": "3845.68", "other_taxes": null, "total": "27881.18", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "05.CIENTÍFICA SENNA, SALMONELLA ENTERICA SUBSP. ENTERICA SEROVAR TYPHIMURUM MARCA ATCC CATALOGO 14028 TUBO 0.25 ML, MARCA ATCC, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4900", "subtotal": "4900", "tax": "784", "other_taxes": null, "total": "5684", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "05.CIENTÍFICA SENNA, CAMPYLOBACTER JEJUNI MARCA ATCC CATALOGO 33291 VIAL, MARCA ATCC, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4389.09", "subtotal": "4389.09", "tax": "702.25", "other_taxes": null, "total": "5091.34", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "05.CIENTÍFICA SENNA, CAMPYLOBACTER LARI BENJAMIN ET AL. MARCA ATCC CATALOGO 6051 VIAL, MARCA ATCC, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "4389.09", "subtotal": "4389.09", "tax": "702.25", "other_taxes": null, "total": "5091.34", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2024-00047623", "internal_reference": "A-015/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "DETECCION MOLECULAR Y ASESORIA ANALITICA SA DE CV", "normalized_name": "DETECCION MOLECULAR Y ASESORIA ANALITICA", "rfc_type": null, "slug": "deteccion-molecular-y-asesoria-analitica" }, "contract_period": { "published_at": "2024-04-25T22:47:57.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-09-30T06:00:00.000Z" }, "value": { "subtotal": "204295.95", "tax": "32687.35", "total": "236983.3", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0048", "description": "06.DETECCIÓN MOLECULAR Y ASESORÍA ANALÍTICA, TUBO CON PERLAS DE LISADO MAGNA LYSER GREEN BEADS MARCA ROCHE CATALOGO 3358941001 PIEZA (PAQUETE 100 PIEZAS), MARCA ROCHE, CADUCIDAD 12 MESES, 13 PIEZA", "unit": "PIEZA", "requested_quantity": "13", "awarded_quantity": null, "unit_price": "11856", "subtotal": "154128", "tax": "24660.48", "other_taxes": null, "total": "178788.48", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0049", "description": "06.DETECCIÓN MOLECULAR Y ASESORÍA ANALÍTICA, REALTIME READY RNA VIRUS MASTER MARCA ROCHE CATALOGO 5619416001 KIT 100 REACCIONES, MARCA ROCHE, CADUCIDAD 10 MESES, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "7884.45", "subtotal": "23653.35", "tax": "3784.54", "other_taxes": null, "total": "27437.89", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "06.DETECCIÓN MOLECULAR Y ASESORÍA ANALÍTICA, FASTSTART TAQMAN® PROBE MASTER MARCA ROCHE CATALOGO 4673409001 KIT DE 100 REACCIONES., MARCA ROCHE , CADUCIDAD 10 MESES, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5088.3", "subtotal": "15264.9", "tax": "2442.38", "other_taxes": null, "total": "17707.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "06.DETECCIÓN MOLECULAR Y ASESORÍA ANALÍTICA, KIT PARA EXTRACCIÓN DE RNA MARCA ROCHE CATALOGO 11858882001 KIT, MARCA ROCHE, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11249.7", "subtotal": "11249.7", "tax": "1799.95", "other_taxes": null, "total": "13049.65", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2024-00047629", "internal_reference": "A-016/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "DICMALAB SA DE CV", "normalized_name": "DICMALAB", "rfc_type": null, "slug": "dicmalab" }, "contract_period": { "published_at": "2024-04-25T22:46:05.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-12-31T06:00:00.000Z" }, "value": { "subtotal": "183000", "tax": "29280", "total": "212280", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "07.DICMALAB, NITROIMIDAZOLES Y AMINOGLUCOSIDOS EN MIEL (STREPTOMICINA Y DIHIDROESTREPTOMICINA) FRASCO DE 40 G, 02581 MARCA FAPAS CATALOGO FCVD14-HON2 FRASCO, MARCA FAPAS, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "46500", "subtotal": "46500", "tax": "7440", "other_taxes": null, "total": "53940", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "07.DICMALAB, TETRACICLINAS EN MÚSCULO DE PESCADO FRASCO DE 20G, 02574 MARCA FAPAS CATALOGO FCVD22-SEA13 FRASCO, MARCA FAPAS, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "46500", "subtotal": "46500", "tax": "7440", "other_taxes": null, "total": "53940", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "07.DICMALAB, TRANQUILIZANTES EN MÚSCULO DE CERDO FRASCO DE 20G, 02567 MARCA FAPAS CATALOGO FCVD32-MRP32 FRASCO, MARCA FAPAS, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "46500", "subtotal": "46500", "tax": "7440", "other_taxes": null, "total": "53940", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "07.DICMALAB, AFLATOXINA M1 EN LECHE EN POLVO LITRO (FRASCO DE 55G, 04526 MARCA FAPAS CATALOGO FCMA1-DRY14 LITRO (FRASCO), MARCA FAPAS, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "43500", "subtotal": "43500", "tax": "6960", "other_taxes": null, "total": "50460", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2024-00047650", "internal_reference": "A-017/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "HYGIENA MEXICO SA DE CV", "normalized_name": "HYGIENA MEXICO", "rfc_type": null, "slug": "hygiena-mexico" }, "contract_period": { "published_at": "2024-04-25T22:45:14.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-09-30T06:00:00.000Z" }, "value": { "subtotal": "2890747.64", "tax": "462519.62", "total": "3353267.26", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "08.HYGIENA MÉXICO, BAX SYSTEM PCR ASSAY REAL TIME SALMONELLA MARCA HYGIENA CATALOGO KIT2006/D14306040 PIEZA KIT 96 PRUEBAS, MARCA HYGIENA, CADUCIDAD 12 MESES, 42 LITRO", "unit": "LITRO", "requested_quantity": "42", "awarded_quantity": null, "unit_price": "37474.49", "subtotal": "1573928.58", "tax": "251828.57", "other_taxes": null, "total": "1825757.15", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "08.HYGIENA MÉXICO, BAX REAL TIME PCR ASSAY STEC SCREENING STX Y EAE MARCA HYGIENA CATALOGO KIT2021/D14642964 KIT 96 REACCIONES, MARCA HYGIENA, CADUCIDAD 12 MESES, 12 LITRO", "unit": "LITRO", "requested_quantity": "12", "awarded_quantity": null, "unit_price": "37474.49", "subtotal": "449693.88", "tax": "71951.02", "other_taxes": null, "total": "521644.9", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "08.HYGIENA MÉXICO, BAX SYSTEM PCR ASSAY REAL TIME L. MONOCYTOGENES MARCA HYGIENA CATALOGO KIT2005/D15134303 PIEZA KIT 96 PRUEBAS, MARCA HYGIENA, CADUCIDAD 12 MESES, 10 LITRO", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "37474.49", "subtotal": "374744.9", "tax": "59959.18", "other_taxes": null, "total": "434704.08", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "08.HYGIENA MÉXICO, BAX PCR ASSAY REAL TIME STEC PANEL 2, 48 REACCIONES PCR BAX MARCA HYGIENA CATALOGO KIT2009/D14642987 KIT 48 REACCIONES, MARCA HYGIENA, CADUCIDAD 12 MESES, 10 LITRO", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "18736.73", "subtotal": "187367.3", "tax": "29978.77", "other_taxes": null, "total": "217346.07", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "08.HYGIENA MÉXICO, BAX SYSTEM PCR ASSAY REAL TIME STEC PANEL 1, 48 REACCIONES PCR BAX®SYSTEM MARCA HYGIENA CATALOGO KIT2008/D14642970 KIT 48 REACCIONES, MARCA HYGIENA, CADUCIDAD 12 MESES, 10 LITRO", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "18736.73", "subtotal": "187367.3", "tax": "29978.77", "other_taxes": null, "total": "217346.07", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "08.HYGIENA MÉXICO, BAX SYSTEM REAL TIME PCR ASSAY MARCA HYGIENA CATALOGO KIT2000 KIT 96 PRUEBAS, MARCA HYGIENA, CADUCIDAD 12 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "37474.49", "subtotal": "74948.98", "tax": "11991.84", "other_taxes": null, "total": "86940.82", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0048", "description": "08.HYGIENA MÉXICO, CLUSTER BAX SYSTEM RACK DE 96 TUBOS MARCA HYGIENA CATALOGO MIS2012 PIEZA (PAQUETE 10 RACKS DE 96 TUBOS CADA RACK), MARCA HYGIENA, CADUCIDAD N/A, 4 PIEZA", "unit": "PIEZA", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "5776.6", "subtotal": "23106.4", "tax": "3697.02", "other_taxes": null, "total": "26803.42", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0057", "description": "08.HYGIENA MÉXICO, CLUSTER TUBE CAPS-BAX SYSTEM-BAG OF 120 MARCA HYGIENA CATALOGO CAP2008 CAJA 120, MARCA HYGIENA, CADUCIDAD N/A, 10 PIEZA", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "1959.03", "subtotal": "19590.3", "tax": "3134.45", "other_taxes": null, "total": "22724.75", "cucop_description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] }, { "id": "C-2024-00047668", "internal_reference": "A-018/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "MOTIBUS SA DE CV", "normalized_name": "MOTIBUS", "rfc_type": null, "slug": "motibus" }, "contract_period": { "published_at": "2024-04-25T22:44:34.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-11-15T06:00:00.000Z" }, "value": { "subtotal": "1478400", "tax": "236544", "total": "1714944", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "09.MOTIBUS, KIT DE ELISA CLENBUTEROL MARCA RANDOX CATALOGO CB1418 KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 22 LITRO", "unit": "LITRO", "requested_quantity": "22", "awarded_quantity": null, "unit_price": "19200", "subtotal": "422400", "tax": "67584", "other_taxes": null, "total": "489984", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "09.MOTIBUS, KIT 19 NORTESTOSTERONE MARCA RANDOX CATALOGO NT2105 KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 15 LITRO", "unit": "LITRO", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "19200", "subtotal": "288000", "tax": "46080", "other_taxes": null, "total": "334080", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "09.MOTIBUS, KIT DE ELISA TETRACICLINAS MARCA RANDOX CATALOGO TCS10117-A/B KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 10 LITRO", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "19200", "subtotal": "192000", "tax": "30720", "other_taxes": null, "total": "222720", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "09.MOTIBUS, KIT DE ELISA PARA DETERMINACION ETINILESTRADIOL MARCA RANDOX CATALOGO RLS9225 KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 8 LITRO", "unit": "LITRO", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "19200", "subtotal": "153600", "tax": "24576", "other_taxes": null, "total": "178176", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "09.MOTIBUS, KIT DE ELISA PARA LA DETERMINACION TRENBOLONA MARCA RANDOX CATALOGO TB 2106 KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 8 LITRO", "unit": "LITRO", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "19200", "subtotal": "153600", "tax": "24576", "other_taxes": null, "total": "178176", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0120", "description": "09.MOTIBUS, COLUMNA INMUNOAFINIDAD PARA PROMOTORES CRECIMIENTO BOLDENONA ZERANOL RACTOPAMINA Y CORTICOESTEROIDES EN ORINA Y TEJIDO MARCA RANDOX CATALOGO GP1821 PIEZA (CAJA 5 PIEZAS), MARCA RANDOX, CADUCIDAD N/A, 8 PIEZA", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "19200", "subtotal": "153600", "tax": "24576", "other_taxes": null, "total": "178176", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0049", "description": "09.MOTIBUS, KIT DE ELISA PARA PHENYLBUTAZONE MARCA RANDOX CATALOGO PB3456 KIT 96 PRUEBAS, MARCA RANDOX, CADUCIDAD 12 MESES, 6 LITRO", "unit": "LITRO", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "19200", "subtotal": "115200", "tax": "18432", "other_taxes": null, "total": "133632", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2024-00047669", "internal_reference": "A-019/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "OMG INTERNATIONAL SA DE CV", "normalized_name": "OMG INTERNATIONAL", "rfc_type": null, "slug": "omg-international" }, "contract_period": { "published_at": "2024-04-25T22:44:22.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-09-30T06:00:00.000Z" }, "value": { "subtotal": "381522.85", "tax": "61043.66", "total": "442566.51", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "10.OMG INTERNATIONAL, KIT E. COLI O103 MARCA EUROFINS ABRAXIS CATALOGO 541020 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 5 LITRO", "unit": "LITRO", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "13402.13", "subtotal": "67010.63", "tax": "10721.7", "other_taxes": null, "total": "77732.33", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "10.OMG INTERNATIONAL, KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O26 MARCA EUROFINS ABRAXIS CATALOGO 541000 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 5 LITRO", "unit": "LITRO", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "13402.13", "subtotal": "67010.63", "tax": "10721.7", "other_taxes": null, "total": "77732.33", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "10.OMG INTERNATIONAL, KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O45 MARCA EUROFINS ABRAXIS CATALOGO 541010 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 5 LITRO", "unit": "LITRO", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "13402.13", "subtotal": "67010.63", "tax": "10721.7", "other_taxes": null, "total": "77732.33", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "10.OMG INTERNATIONAL, KIT E. COLI O111 MARCA EUROFINS ABRAXIS CATALOGO 541030 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "13402.13", "subtotal": "53608.5", "tax": "8577.36", "other_taxes": null, "total": "62185.86", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "10.OMG INTERNATIONAL, KIT E. COLI O121 MARCA EUROFINS ABRAXIS CATALOGO 541040 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "13402.13", "subtotal": "53608.5", "tax": "8577.36", "other_taxes": null, "total": "62185.86", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "10.OMG INTERNATIONAL, KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O145 MARCA EUROFINS ABRAXIS CATALOGO 541050 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "13402.13", "subtotal": "53608.5", "tax": "8577.36", "other_taxes": null, "total": "62185.86", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "10.OMG INTERNATIONAL, PERLAS DE INMUNOSEPARACION PARA E. COLI O157:H7 MARCA EUROFINS ABRAXIS CATALOGO 543070 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10589.16", "subtotal": "10589.16", "tax": "1694.27", "other_taxes": null, "total": "12283.43", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "10.OMG INTERNATIONAL, KIT PARA PRUEBA DE AGLUTINACIÓN LATEX, E. COLI O157:H7 MARCA EUROFINS ABRAXIS CATALOGO 541070 KIT 50 PRUEBAS, MARCA EUROFINS ABRAXIS, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "9076.3", "subtotal": "9076.3", "tax": "1452.21", "other_taxes": null, "total": "10528.51", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2024-00047670", "internal_reference": "A-020/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "QUADRIX SA DE CV", "normalized_name": "QUADRIX", "rfc_type": null, "slug": "quadrix" }, "contract_period": { "published_at": "2024-04-25T22:44:08.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-09-30T06:00:00.000Z" }, "value": { "subtotal": "1428682", "tax": "228589.12", "total": "1657271.12", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0049", "description": "11.QUADRIX, KIT DE ELISA CLENBUTEROL MARCA R-BIOPHARM CATALOGO R1711 PIEZA KIT 96 PRUEBAS, MARCA R-BIOPHARM, CADUCIDAD 12 MESES, 42 LITRO", "unit": "LITRO", "requested_quantity": "42", "awarded_quantity": null, "unit_price": "15423", "subtotal": "647766", "tax": "103642.56", "other_taxes": null, "total": "751408.56", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "11.QUADRIX, KIT DE ELISA PARA LA DETERMINACION AZAPERONE-AZAPEROL MARCA EUROPROXIMA CATALOGO 5201AZA KIT 96 PRUEBAS, MARCA EUROPROXIMA, CADUCIDAD 12 MESES, 15 LITRO", "unit": "LITRO", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "16023", "subtotal": "240345", "tax": "38455.2", "other_taxes": null, "total": "278800.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "11.QUADRIX, KIT DE ELISA PARA LA DETERMINACIÓN CARAZOLOL MARCA EUROPROXIMA CATALOGO 5201CARA KIT 96 PRUEBAS, MARCA EUROPROXIMA, CADUCIDAD 12 MESES, 14 LITRO", "unit": "LITRO", "requested_quantity": "14", "awarded_quantity": null, "unit_price": "16023", "subtotal": "224322", "tax": "35891.52", "other_taxes": null, "total": "260213.52", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "11.QUADRIX, KIT DE ELISA ESTREPTOMICINA MARCA R-BIOPHARM CATALOGO R3104 KIT 96 PRUEBAS, MARCA R-BIOPHARM, CADUCIDAD 12 MESES, 10 LITRO", "unit": "LITRO", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "17889", "subtotal": "178890", "tax": "28622.4", "other_taxes": null, "total": "207512.4", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "11.QUADRIX, KIT DE ELISA PARA LA DETERMINACION ETINILESTRADIOL MARCA EUROPROXIMA CATALOGO 5081ESTR KIT 96 PRUEBAS, MARCA EUROPROXIMA, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "16534", "subtotal": "66136", "tax": "10581.76", "other_taxes": null, "total": "76717.76", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0082", "description": "11.QUADRIX, CARTUCHOS DE EXTRACCIÓN RIDA C18 MARCA R-BIOPHARM CATALOGO R-2002 PIEZA (CAJA 100 PIEZAS), MARCA R-BIOPHARM, CADUCIDAD N/A, 6 PIEZA", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "6489", "subtotal": "38934", "tax": "6229.44", "other_taxes": null, "total": "45163.44", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "11.QUADRIX, KIT DE HISTAMINA POR ELISAS MARCA RIDASCREEN CATALOGO R1605 KIT, MARCA RIDASCREEN, CADUCIDAD 12 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "19311", "subtotal": "19311", "tax": "3089.76", "other_taxes": null, "total": "22400.76", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "11.QUADRIX, DECOLORANTE MUESTRAS MARCA R-BIOPHARM CATALOGO R1699 KIT 400 PRUEBAS, MARCA R-BIOPHARM, CADUCIDAD 12 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6489", "subtotal": "12978", "tax": "2076.48", "other_taxes": null, "total": "15054.48", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2024-00047685", "internal_reference": "A-021/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "UNIPARTS SA DE CV", "normalized_name": "UNIPARTS", "rfc_type": null, "slug": "uniparts" }, "contract_period": { "published_at": "2024-04-25T22:43:50.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-09-30T06:00:00.000Z" }, "value": { "subtotal": "1473602.09", "tax": "235776.33", "total": "1709378.42", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0120", "description": "12.UNIPARTS, MINICOLUMNS WIZARD SV GEL AND PCR CLEAN-UP SYSTEM MARCA PROMEGA CATALOGO A129B PIEZA (PAQUETE 250 PIEZAS), MARCA PROMEGA, CADUCIDAD 12 MESES, 43 PIEZA", "unit": "PIEZA", "requested_quantity": "43", "awarded_quantity": null, "unit_price": "8128.28", "subtotal": "349516.04", "tax": "55922.57", "other_taxes": null, "total": "405438.61", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0048", "description": "12.UNIPARTS, COLLECTION TUBES MARCA PROMEGA CATALOGO A130B PIEZA (PAQUETE 250 PIEZAS), MARCA PROMEGA, CADUCIDAD N/A, 30 PIEZA", "unit": "PIEZA", "requested_quantity": "30", "awarded_quantity": null, "unit_price": "7884.43", "subtotal": "236532.9", "tax": "37845.26", "other_taxes": null, "total": "274378.16", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "12.UNIPARTS, SOLUCIÓN MAESTRA PARA PCR 2X CONTIENE TODOS LOS REACTIVOS PARA LA REACCIÓN EXCEPTO INICIADORES Y ADN BLANCO PARA 1000 REACCIONES (PCR MASTER MIX) MARCA PROMEGA CATALOGO M7505 FRASCO 25 ML, MARCA PROMEGA, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "26563.52", "subtotal": "106254.08", "tax": "17000.65", "other_taxes": null, "total": "123254.73", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0120", "description": "12.UNIPARTS, MINICOLUMNS WIZARD Y COLLECTION TUBES MARCA PROMEGA CATALOGO A1460 PIEZA (PAQUETE), MARCA PROMEGA, CADUCIDAD 12 MESES, 8 PIEZA", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "8556.08", "subtotal": "68448.64", "tax": "10951.78", "other_taxes": null, "total": "79400.42", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "12.UNIPARTS, SISTEMA DE PURIFICACIÓN DE ADN GENÓMICO WIZARD SV MARCA PROMEGA CATALOGO A2361 CAJA (250 REACCIONES), MARCA PROMEGA, CADUCIDAD 12 MESES, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "14004.9", "subtotal": "42014.7", "tax": "6722.35", "other_taxes": null, "total": "48737.05", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: IMNV P CCACCTTTACTTTCAATACTACATCATCCCCGG ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "14229", "subtotal": "28458", "tax": "4553.28", "other_taxes": null, "total": "33011.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: PVNV P TTACGTCCCAGCGGTGCCAAATA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "14229", "subtotal": "28458", "tax": "4553.28", "other_taxes": null, "total": "33011.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: YHV P CCATCAAAGCTCTCAACGCCGTCA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "14229", "subtotal": "28458", "tax": "4553.28", "other_taxes": null, "total": "33011.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: SHRIMP P AGACTAATGATTATGCTACCTTCGCACGGT ESCALA: 1 µM DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: CY5/TAO/3’ IB RQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "13486.5", "subtotal": "26973", "tax": "4315.68", "other_taxes": null, "total": "31288.68", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "12.UNIPARTS, PROTEINASA K MARCA PROMEGA CATALOGO A5051 FRASCO 23 ML, MARCA PROMEGA, CADUCIDAD 12 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "12681.36", "subtotal": "25362.72", "tax": "4058.04", "other_taxes": null, "total": "29420.76", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SISTEMA COMERCIAL PARA LA PURIFICACIÓN A PARTIR DE SANGRE MARCA PROMEGA CATALOGO A5081 KIT, MARCA PROMEGA, CADUCIDAD 10 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11665.62", "subtotal": "23331.24", "tax": "3733", "other_taxes": null, "total": "27064.24", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, NPI-S /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ///56-FAM/TA CAT AGG C/ZEN/A AAA CCA AAG GAG ACA C/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y\nELECTROSPRAY (ESI). MARCA: IDT PRESENTACIÓN: VIAL. MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "11475", "subtotal": "22950", "tax": "3672", "other_taxes": null, "total": "26622", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, GO TAQ LONG PCR MASTER MIX MARCA PROMEGA CATALOGO M4021 KIT 100 REACCIONES, MARCA PROMEGA, CADUCIDAD 10 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "9454.4", "subtotal": "18908.8", "tax": "3025.41", "other_taxes": null, "total": "21934.21", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, RUM16S-P /// 1 µM AFFINITY PLUS® 5´ 6-FAM™ / 3´ IB®FQ /// HPLC /// 56-FAM/AG TTC AGC TTT AAA RA+T +A+C+C +AA/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16098.75", "subtotal": "16098.75", "tax": "2575.8", "other_taxes": null, "total": "18674.55", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, GBLOCKS GENE FRAGMENTS MARCA IDT CATALOGO GBLOCKS-1 KIT, MARCA IDT, CADUCIDAD N/A, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5130", "subtotal": "15390", "tax": "2462.4", "other_taxes": null, "total": "17852.4", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, 16S RRNA PROBE 5’ 5TYE665-GTG GGG TAA CGG CTC ACC TAG GCG AC-3IABRQSP 3’ MARCA IDT CATALOGO SINTESIS LITRO (PIEZA) , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15025.5", "subtotal": "15025.5", "tax": "2404.08", "other_taxes": null, "total": "17429.58", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, EAE PROBE 5’ 5MAXN-ATA GTC TCG CCA GTA TTC GCC ACC AAT ACC-IABKFQ 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "15025.5", "subtotal": "15025.5", "tax": "2404.08", "other_taxes": null, "total": "17429.58", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: TILV-93S FAM/CTCTACCAGCTAGTGCCCCA/-IOWA BLACK ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO IDT-01 KIT, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14229", "subtotal": "14229", "tax": "2276.64", "other_taxes": null, "total": "16505.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: VHS-S: FAM/TACGCCATCATGATGAGT/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14229", "subtotal": "14229", "tax": "2276.64", "other_taxes": null, "total": "16505.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: AB P CAA CTC TTC GCA TGA GGT GGC CAA A ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14229", "subtotal": "14229", "tax": "2276.64", "other_taxes": null, "total": "16505.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: HPB S CCGCCCGTCAAGCCATGGAA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14229", "subtotal": "14229", "tax": "2276.64", "other_taxes": null, "total": "16505.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: IHNV-S TGAGACTGAGCGGGACA/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14229", "subtotal": "14229", "tax": "2276.64", "other_taxes": null, "total": "16505.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: MRNV RNA1 P: ACCCTTCGACCCCAGCAATGGTG ESCALA: 1 µM DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14229", "subtotal": "14229", "tax": "2276.64", "other_taxes": null, "total": "16505.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: OSHV P TGCCCCTGTCATCTTGAGGTATAGACAATC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14229", "subtotal": "14229", "tax": "2276.64", "other_taxes": null, "total": "16505.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SONDA: XSV P CATGCCCCATGATCCTCGCA ESCALA: 1 µM DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "14229", "subtotal": "14229", "tax": "2276.64", "other_taxes": null, "total": "16505.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: RUM16S-RV: ACTTTTAAARMTACAGTGRRATTTATTT ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5905.8", "subtotal": "11811.6", "tax": "1889.86", "other_taxes": null, "total": "13701.46", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, STX1 PROBE 5’ 56-FAM-CTG GAT GAT/ZEN/CTC AGT GGG CGT TCT TAT GTA A-3IABKFQ 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11475", "subtotal": "11475", "tax": "1836", "other_taxes": null, "total": "13311", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, STX2 PROBE 5’ 56-FAM-TCG TCA GGC/ZEN/ACT GTC TGA AAC TGC TCC-3IABKFQ 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "11475", "subtotal": "11475", "tax": "1836", "other_taxes": null, "total": "13311", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: SHRIMP R GTCCAACCATTCATACAAGCC ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5502.6", "subtotal": "11005.2", "tax": "1760.83", "other_taxes": null, "total": "12766.03", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: SHRIMP F AAGTCTAGCCTGCCCACTG ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5387.4", "subtotal": "10774.8", "tax": "1723.97", "other_taxes": null, "total": "12498.77", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, SISTEMA DE PURIFICACIÓN DE ADN WIZARD MARCA PROMEGA CATALOGO A1125 KIT 500 REACCIONES, MARCA PROMEGA, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10136.88", "subtotal": "10136.88", "tax": "1621.9", "other_taxes": null, "total": "11758.78", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "12.UNIPARTS, PROTEINASA K SOLUCIÓN MARCA PROMEGA CATALOGO MC5005 FRASCO 4ML, MARCA PROMEGA, CADUCIDAD 10 MESES, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4322.88", "subtotal": "8645.76", "tax": "1383.32", "other_taxes": null, "total": "10029.08", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: IMNV F GGACCTATCATACATAGCGTTTGCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3510", "subtotal": "7020", "tax": "1123.2", "other_taxes": null, "total": "8143.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: IMNV R AACCCATATCTATTGTCGCTGGAT ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3483", "subtotal": "6966", "tax": "1114.56", "other_taxes": null, "total": "8080.56", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: PVNV F TGGGAACGCTATAAGTGGTTATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3456", "subtotal": "6912", "tax": "1105.92", "other_taxes": null, "total": "8017.92", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: PVNV R ATCGTCGAGAGGATCAGTATCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3429", "subtotal": "6858", "tax": "1097.28", "other_taxes": null, "total": "7955.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: YHV R CCAGTGACGTTCGATGCAATA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3402", "subtotal": "6804", "tax": "1088.64", "other_taxes": null, "total": "7892.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: YHV F CGTCCCGGCAATTGTGATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3348", "subtotal": "6696", "tax": "1071.36", "other_taxes": null, "total": "7767.36", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MRNV-RNA1 R AGGAAATACACGAGCAAGAAAAGTC ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5733", "subtotal": "5733", "tax": "917.28", "other_taxes": null, "total": "6650.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MR-18SRRNA R GTCCCGCATTGTTATTTTTCGTCA ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5675.4", "subtotal": "5675.4", "tax": "908.06", "other_taxes": null, "total": "6583.46", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MRNV-RNA1 F CAACTCGGTATGGAACTCAAGGT ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5617.8", "subtotal": "5617.8", "tax": "898.85", "other_taxes": null, "total": "6516.65", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MR-18SRRNA F CGCACCGGCTCCGTATCTTT ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5445", "subtotal": "5445", "tax": "871.2", "other_taxes": null, "total": "6316.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: XSV F AGCCACACTCTCGCATCTGA ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5445", "subtotal": "5445", "tax": "871.2", "other_taxes": null, "total": "6316.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: XSV R CTCCAGCAAAGTGCGATACG ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5445", "subtotal": "5445", "tax": "871.2", "other_taxes": null, "total": "6316.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: RUM16S-FW: TGGTTGTCCAGAAGATG ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5272.2", "subtotal": "5272.2", "tax": "843.55", "other_taxes": null, "total": "6115.75", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0120", "description": "12.UNIPARTS, WIZARD SV GEL MINICOLUMNS MARCA PROMEGA CATALOGO A9281 PIEZA (KIT PARA 50 REACCIONES), MARCA PROMEGA, CADUCIDAD 10 MESES, 2 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2588.56", "subtotal": "5177.12", "tax": "828.34", "other_taxes": null, "total": "6005.46", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, NPI-FW /// 100 NMOLE DNA OLIGO /// HPLC /// GTT GAT MMA STA CAC CGG AG. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2045.25", "subtotal": "4090.5", "tax": "654.48", "other_taxes": null, "total": "4744.98", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, NPI-RV /// 100 NMOLE DNA OLIGO /// HPLC /// AGG TCH CKT ATG AAG GAG TC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 2 LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2045.25", "subtotal": "4090.5", "tax": "654.48", "other_taxes": null, "total": "4744.98", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, STX F (FORWARD) 5’ TTT GTY ACT GTS ACA GCW GAA GCY TTA CG 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3618", "subtotal": "3618", "tax": "578.88", "other_taxes": null, "total": "4196.88", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, EAE F (FORWARD) 5’ CAT TGA TCA GGA TTT TTC TGG TGA TA 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3537", "subtotal": "3537", "tax": "565.92", "other_taxes": null, "total": "4102.92", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, STX R (REVERSE) 5’ CCC CAG TTC ARW GTR AGR TCM ACD TC 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3537", "subtotal": "3537", "tax": "565.92", "other_taxes": null, "total": "4102.92", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: HPB R TTATCTTTTCTTTAAGGCGATGAGC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3510", "subtotal": "3510", "tax": "561.6", "other_taxes": null, "total": "4071.6", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: PRIMERB GAA GGA ATG ATG CTA AAG CTG AAA C ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3510", "subtotal": "3510", "tax": "561.6", "other_taxes": null, "total": "4071.6", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: PRIMER A CCA GCA TCA GAG TCT TTT CCA AAT ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3483", "subtotal": "3483", "tax": "557.28", "other_taxes": null, "total": "4040.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: VHS-RV: TGTAGTAGGACTCTCCCAGCATCC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3483", "subtotal": "3483", "tax": "557.28", "other_taxes": null, "total": "4040.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "12.UNIPARTS, BLUE ORANGE LOADING DYE 6X MARCA PROMEGA CATALOGO G1881 FRASCO 3 ML, MARCA PROMEGA, CADUCIDAD 12 MESES, 4 LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "857.28", "subtotal": "3429.12", "tax": "548.66", "other_taxes": null, "total": "3977.78", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: OSHV F GTCGCATCTTTGGATTTAACAA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3429", "subtotal": "3429", "tax": "548.64", "other_taxes": null, "total": "3977.64", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, 16SRNA-R (REVERSE) – 5’ GGC TGG TCA TCC TCT CAG ACC 3’ MARCA IDT CATALOGO SINTESIS LITRO (PIEZA) , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3402", "subtotal": "3402", "tax": "544.32", "other_taxes": null, "total": "3946.32", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, EAER (REVERSE) 5’ CTC ATG CGG AAA TAG CCG TTM 3’ MARCA IDT CATALOGO SINTESIS PIEZA , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3402", "subtotal": "3402", "tax": "544.32", "other_taxes": null, "total": "3946.32", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, MCR8_FW: 5’ TCA ACA ATT CTA CAA AGC GTG 3’ TAMAÑO 856 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3402", "subtotal": "3402", "tax": "544.32", "other_taxes": null, "total": "3946.32", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, MCR6_FW: 5’ AGC TAT GTC AAT CCC GTG AT 3’ TAMAÑO 252 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPA GATCTGCAAGAGGACAAACC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPB ATCGCTAAGCTCTGGCATCC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPD TGTTCTCAGCCAATACATCG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPE TACATCTTGGATGCCTCTGC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPF TACCCTGCATTCCTTGTCGC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BPG ATCCTGTTTCCAAGCTCTGC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: HPB F CGTTCACGGGCCTTGTACAC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MRNV-2 F GATGACCCCAACGTTATCCT ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: MRNV-2 R GTGTAGTCACTTGCAAGAGG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: OSHV R ACTGGGATCCGACTGACAAC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3375", "subtotal": "3375", "tax": "540", "other_taxes": null, "total": "3915", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, 16SRNA-F (FORWARD) – 5’ CCT CTT GCC ATC GGA TGT G 3’ MARCA IDT CATALOGO SINTESIS LITRO (PIEZA) , MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3348", "subtotal": "3348", "tax": "535.68", "other_taxes": null, "total": "3883.68", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, MCR6_REV: 5’ ATT GGC TAG GTT GTC AAT C 3’ TAMAÑO 252 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3348", "subtotal": "3348", "tax": "535.68", "other_taxes": null, "total": "3883.68", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: IHNV-FW: AGAGCCAAGGCACTGTGCG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3348", "subtotal": "3348", "tax": "535.68", "other_taxes": null, "total": "3883.68", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: IHNV-RV: TTCTTTGCGGCTTGGTTGA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3348", "subtotal": "3348", "tax": "535.68", "other_taxes": null, "total": "3883.68", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: VHS-FW: ATGAGGCAGGTGTCGGAGG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3348", "subtotal": "3348", "tax": "535.68", "other_taxes": null, "total": "3883.68", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, MCR7_FW: 5’ GCC CTT CTT TTC GTT GTT 3’ TAMAÑO 551 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3321", "subtotal": "3321", "tax": "531.36", "other_taxes": null, "total": "3852.36", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, MCR7_REV: 5’ GGT TGG TCT CTT TCT CGT 3’ TAMAÑO 551 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3321", "subtotal": "3321", "tax": "531.36", "other_taxes": null, "total": "3852.36", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, MCR8_REV: 5’ AAT GCT GCG CGA ATG AAG 3’ TAMAÑO 856 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3321", "subtotal": "3321", "tax": "531.36", "other_taxes": null, "total": "3852.36", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, MCR9_FW: 5’ TTC CCT TTG TTC TGG TTG 3’ TAMAÑO 1011 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3321", "subtotal": "3321", "tax": "531.36", "other_taxes": null, "total": "3852.36", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, MCR9_REV: GCA GGT AAT AAG TCG GTC TAMAÑO 1011 (BP) MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3321", "subtotal": "3321", "tax": "531.36", "other_taxes": null, "total": "3852.36", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BP-6581 TGTAGCAGCAGAGAAGAG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3321", "subtotal": "3321", "tax": "531.36", "other_taxes": null, "total": "3852.36", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: BP-6582 CACTAAGCCTATCTCCAG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3321", "subtotal": "3321", "tax": "531.36", "other_taxes": null, "total": "3852.36", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: TILV-93R: CTGCTTGAGTTGTGCTTCT ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2029.05", "subtotal": "2029.05", "tax": "324.65", "other_taxes": null, "total": "2353.7", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "12.UNIPARTS, OLIGONUCLEOTIDO: TILV-93F: AGCCTGCCACACAGAAG ESCALA: 100NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA, MARCA IDT, CADUCIDAD N/A, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1996.65", "subtotal": "1996.65", "tax": "319.46", "other_taxes": null, "total": "2316.11", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "12.UNIPARTS, AGUA LIBRE DE NUCLEASAS MARCA PROMEGA CATALOGO P1193 LITRO (FRASCO 50 ML), MARCA PROMEGA, CADUCIDAD 10 MESES, 1 LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "1112.64", "subtotal": "1112.64", "tax": "178.02", "other_taxes": null, "total": "1290.66", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2024-00047688", "internal_reference": "A-022/2024", "title": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "status": "PUBLICADO", "contractor": { "name": "WATERS SA DE CV", "normalized_name": "WATERS", "rfc_type": null, "slug": "waters" }, "contract_period": { "published_at": "2024-04-25T22:43:15.000Z", "starts_at": "2024-02-28T06:00:00.000Z", "ends_at": "2024-09-30T06:00:00.000Z" }, "value": { "subtotal": "1318668.28", "tax": "210986.92", "total": "1529655.2", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0061", "description": "13.WATERS, ACRODISCOS PTFE DE 13MM, 0.2µM.CON PUNTA MINISPIKE MARCA WATERS CATALOGO WAT200824 PIEZA (PAQUETE 1000 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 8 PIEZA", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "35775.484", "subtotal": "286203.87", "tax": "45792.62", "other_taxes": null, "total": "331996.49", "cucop_description": "ACRODISCOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "13.WATERS, CARTUCHOS DE EXTRACCIÓN DE FASE SÓLIDA OASIS HLB 6 CC (200 MG) MARCA WATERS CATALOGO WAT106202 PIEZA (CAJA 30 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 60 PIEZA", "unit": "PIEZA", "requested_quantity": "60", "awarded_quantity": null, "unit_price": "4448.3", "subtotal": "266898", "tax": "42703.68", "other_taxes": null, "total": "309601.68", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0061", "description": "13.WATERS, ACRODISCOS PTFE 0,45µM X 4MM MARCA WATERS CATALOGO WAT200508 PIEZA (PAQUETE 250 PIEZA), MARCA WATERS, CADUCIDAD N/A, 15 PIEZA", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "10960.8605", "subtotal": "164412.91", "tax": "26306.06", "other_taxes": null, "total": "190718.97", "cucop_description": "ACRODISCOS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "13.WATERS, CARTUCHOS DE ALUMINA B SEP-PAK CLASSIC MARCA WATERS CATALOGO WAT051820 PIEZA (CAJA 50 PIEZA), MARCA WATERS, CADUCIDAD N/A, 15 PIEZA", "unit": "PIEZA", "requested_quantity": "15", "awarded_quantity": null, "unit_price": "5044.324", "subtotal": "75664.86", "tax": "12106.38", "other_taxes": null, "total": "87771.24", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0083", "description": "13.WATERS, SEPTA PREHORADADAS PTFE DE SILICÓN DE PS 8 MILÍMETROS MARCA WATERS CATALOGO WAT058876 PIEZA (PAQUETE 100 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 80 PIEZA", "unit": "PIEZA", "requested_quantity": "80", "awarded_quantity": null, "unit_price": "944.9025", "subtotal": "75592.2", "tax": "12094.75", "other_taxes": null, "total": "87686.95", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0082", "description": "13.WATERS, CARTUCHOS DE EXTRACCIÓN DE SILICA SEP-PAK VAC 6 CC (1G) MARCA WATERS CATALOGO WAT036910 PIEZA (PAQUETE 30 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 20 PIEZA", "unit": "PIEZA", "requested_quantity": "20", "awarded_quantity": null, "unit_price": "3038.22", "subtotal": "60764.4", "tax": "9722.3", "other_taxes": null, "total": "70486.7", "cucop_description": "FILTROS", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0087", "description": "13.WATERS, CONE GAS NOZZLE (# 700004216)/XEVO MARCA WATERS CATALOGO 700004216 PIEZA, MARCA WATERS, CADUCIDAD N/A, 6 PIEZA", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "9512.3", "subtotal": "57073.8", "tax": "9131.81", "other_taxes": null, "total": "66205.61", "cucop_description": "ELECTRODO DE REFERENCIA", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "13.WATERS, COLUMNA HSST3 1.8µM 2.1X100MM MARCA WATERS CATALOGO 186003539 PIEZA, MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "24363.93", "subtotal": "48727.86", "tax": "7796.46", "other_taxes": null, "total": "56524.32", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0122", "description": "13.WATERS, SAMPLE NEEDLE KIT, 15µL, SS (# 700008977) MARCA WATERS CATALOGO 700008977 PIEZA, MARCA WATERS, CADUCIDAD 12 MESES, 3 PIEZA", "unit": "PIEZA", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "15761.482", "subtotal": "47284.45", "tax": "7565.51", "other_taxes": null, "total": "54849.96", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0122", "description": "13.WATERS, ACTIVE PREHEATER (# 205000894) MARCA WATERS CATALOGO 205000894 PIEZA, MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "22934.19", "subtotal": "45868.38", "tax": "7338.94", "other_taxes": null, "total": "53207.32", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0122", "description": "13.WATERS, SAMPLE CONE (CONO DE MUESTRA XEVO TQ/MS) MARCA WATERS CATALOGO 700004219 PIEZA , MARCA WATERS, CADUCIDAD 12 MESES, 5 PIEZA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "5418.01", "subtotal": "27090.05", "tax": "4334.41", "other_taxes": null, "total": "31424.46", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0122", "description": "13.WATERS, SAMPLE CONE MARCA WATERS CATALOGO 700011217 PIEZA, MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "12898.56", "subtotal": "25797.12", "tax": "4127.54", "other_taxes": null, "total": "29924.66", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "13.WATERS, ACQUITY UPLC BEH SHIELD RP18 1.7 µM, 2.1 MM X 100 MM.COLUMN MARCA WATERS CATALOGO 186002854 PIEZA, MARCA WATERS, CADUCIDAD N/A, 1 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "24363.93", "subtotal": "24363.93", "tax": "3898.23", "other_taxes": null, "total": "28262.16", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "13.WATERS, ACQUITY UPLC HSS PFP COLUMN, 100Å, 1.8 µM, 2.1 MM X 100 MM, 1/PKG MARCA WATERS CATALOGO 1860005967 PIEZA, MARCA WATERS, CADUCIDAD N/A, 1 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "24363.93", "subtotal": "24363.93", "tax": "3898.23", "other_taxes": null, "total": "28262.16", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "13.WATERS, ACQUITY UPLC BEH SHIELD RP18 VANGUARD PRE-COLUMN 130Å 1.7 µM 2.1 MM X 5 MM MARCA WATERS CATALOGO 186003977 PIEZA (PAQUETE 3 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 1 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "17269.9", "subtotal": "17269.9", "tax": "2763.18", "other_taxes": null, "total": "20033.08", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25101-0037", "description": "13.WATERS, PIC A REAGENT MARCA WATERS CATALOGO WAT085101 PAQUETE 5 PIEZA, MARCA WATERS, CADUCIDAD 12 MESES, 3 LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "4913.492", "subtotal": "14740.48", "tax": "2358.47", "other_taxes": null, "total": "17098.95", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25501-0058", "description": "13.WATERS, 96-WELL SAMPLE COLLECTION PLATE, 800 µL ROUND WELL MARCA WATERS CATALOGO 186002481 PIEZA (CAJA 50 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5989.23", "subtotal": "11978.46", "tax": "1916.55", "other_taxes": null, "total": "13895.01", "cucop_description": "BASE SOPORTE DE MATRACES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0083", "description": "13.WATERS, LCMS CERTIFIED CLEAR GLASS 12 X 32MM SCREW NECK VIAL, WITH CAP AND PRESLIT PTFE/SILICONE SEPTA, 2 ML MARCA WATERS CATALOGO 600000668CV PIEZA (PAQUETE 100 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 6 PIEZA", "unit": "PIEZA", "requested_quantity": "6", "awarded_quantity": null, "unit_price": "1831.657", "subtotal": "10989.94", "tax": "1758.39", "other_taxes": null, "total": "12748.33", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "13.WATERS, SEAT PORT ASSEMBLY, .003 ID (# 700006056) MARCA WATERS CATALOGO 700006056 PIEZA, MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4817.72", "subtotal": "9635.44", "tax": "1541.67", "other_taxes": null, "total": "11177.11", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0083", "description": "13.WATERS, LCMS CERTIFIED AMBER GLASS 12 X 32MM SCREW NECK VIAL, WITH CAP AND PRESLIT PTFE/SILICONE SEPTA, 2 ML MARCA WATERS CATALOGO 600000669CV PIEZA (PAQUETE 100 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 5 PIEZA", "unit": "PIEZA", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "1831.66", "subtotal": "9158.3", "tax": "1465.33", "other_taxes": null, "total": "10623.63", "cucop_description": "POLIMERO (PTFE, SEPTA, FERRULES)", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "13.WATERS, VIAL DE VIDRIO DE 12 X 32 CON TAPA Y SEPTA ALTO RECOBRO MARCA WATERS CATALOGO 600000750CV PIEZA (CAJA 100 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4433.77", "subtotal": "8867.54", "tax": "1418.81", "other_taxes": null, "total": "10286.35", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0077", "description": "13.WATERS, VIAL HOLDER, 48-WELL, 2ML VIAL MARCA WATERS CATALOGO 700011047 PIEZA, MARCA WATERS, CADUCIDAD N/A, 8 PIEZA", "unit": "PIEZA", "requested_quantity": "8", "awarded_quantity": null, "unit_price": "430.974", "subtotal": "3447.79", "tax": "551.65", "other_taxes": null, "total": "3999.44", "cucop_description": "FRASCO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0057", "description": "13.WATERS, TAPA CON SEPTA DE SILICONA/PTFE COLOR VERDE PARA VIAL DE 12 X 32MM MARCA WATERS CATALOGO 186002130 PIEZA (PAQUETE 100 PIEZAS), MARCA WATERS, CADUCIDAD N/A, 2 PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "683.24", "subtotal": "1366.48", "tax": "218.64", "other_taxes": null, "total": "1585.12", "cucop_description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0122", "description": "13.WATERS, HANDLE CONE GAS NOZZLE (XEVO SUJETADOR) MARCA WATERS CATALOGO 700010292 PIEZA, MARCA WATERS, CADUCIDAD N/A, 1 PIEZA", "unit": "PIEZA", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "800.39", "subtotal": "800.39", "tax": "128.06", "other_taxes": null, "total": "928.45", "cucop_description": "ACCESORIOS PARA BUTIROMETRO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0008", "description": "13.WATERS, O-RING VITON 10 I/D X 1.5 C/S (CONO XEVO) MARCA WATERS CATALOGO 700004321 PIEZA, MARCA WATERS, CADUCIDAD N/A, 10 PIEZA", "unit": "PIEZA", "requested_quantity": "10", "awarded_quantity": null, "unit_price": "30.78", "subtotal": "307.8", "tax": "49.25", "other_taxes": null, "total": "357.05", "cucop_description": "CONO REVESTIMIENTO", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "JUSTIFICACIÓN DE EXCEPCIÓN", "filename": "ACTA SEGUNDA SESIÿN ORDINARIA 2024.pdf", "availability": "available", "size_bytes": "827629", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-01T16:03:35.124Z", "updated_at": "2025-12-01T16:03:35.125Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "-Anexo_Tecnico_Comité_Cenapa.pdf", "availability": "available", "size_bytes": "1018988", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-12-01T16:03:38.477Z", "updated_at": "2025-12-01T16:03:38.478Z" }, { "id": null, "annex_number": 4, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "---Oficios Adjudicacion CENAPA.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:03:42.134Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 6, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "N-41Oficios Adjudicacion CENAPA.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:03:45.282Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 7, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "N-41Oficios Adjudicacion CENAPA.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:03:49.520Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 8, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "N-41Oficios Adjudicacion CENAPA.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:03:55.476Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 9, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "N-41Oficios Adjudicacion CENAPA.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:03:57.123Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 10, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "---Oficios Adjudicacion CENAPA.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:04:01.480Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 11, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "Oficios Adjudicacion CENAPA-N41.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:04:04.183Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 12, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "Oficios Adjudicacion CENAPA-N41.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:04:10.574Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 13, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "Oficios Adjudicacion CENAPA-N41.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:04:16.517Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 14, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "Oficios Adjudicacion CENAPA-N41.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:04:20.241Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 15, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "Oficios Adjudicacion CENAPA-N41.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:04:25.664Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 16, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "Oficios Adjudicacion CENAPA-N41.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:04:28.277Z", "updated_at": "2026-08-05T22:17:21.971Z" }, { "id": null, "annex_number": 17, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "Oficios Adjudicacion CENAPA-N41.pdf", "availability": "available", "size_bytes": "1294491", "mime_type": "application/pdf", "sha256": "ff4f2966779dec062b3a6a6068d302a509d3346a66be40ef77086ece6096ad02", "uploaded_at": "2025-12-01T16:04:31.358Z", "updated_at": "2026-08-05T22:17:21.971Z" } ], "provenance": { "source_system": "Compras MX", "source_fetched_at": "2026-07-31T10:54:22.977Z", "last_seen_at": "2026-07-31T11:43:41.720Z", "first_seen_at": "2025-11-05T07:03:18.581Z", "detail_complete": true, "documents_complete": true, "content_changed_at": "2025-11-05T07:03:18.581Z" }, "context": { "prices": [ { "cucop_code": "25501-0082", "description": "FILTROS", "priced_items": 618, "units": [ { "n": 557, "max": 88793.1, "min": 9, "p10": 362.532, "p50": 2620, "p90": 11001, "unidad": "PIEZA" }, { "n": 56, "max": 40560, "min": 1, "p10": 855.65, "p50": 1918.5, "p90": 7385.58, "unidad": "UNIDAD" }, { "n": 4, "max": 12796.66, "min": 60, "p10": 3380.28, "p50": 11962.13, "p90": 12796.66, "unidad": "SERVICIO" } ], "price_by_year": { "2023": { "n": 178, "p50": 3463.755 }, "2024": { "n": 142, "p50": 2550.5 }, "2025": { "n": 172, "p50": 2385.49 }, "2026": { "n": 126, "p50": 2077.195 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0048", "description": "TUBO MUESTRADOR", "priced_items": 1252, "units": [ { "n": 1145, "max": 114987, "min": 0.54, "p10": 154.224, "p50": 579.08, "p90": 3960.4, "unidad": "PIEZA" }, { "n": 98, "max": 8348.6, "min": 1.57, "p10": 203.1, "p50": 635.325, "p90": 3979, "unidad": "UNIDAD" }, { "n": 6, "max": 6034.48, "min": 370.23, "p10": 825.085, "p50": 2131.55, "p90": 4612.065, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 608, "p50": 462.5 }, "2024": { "n": 281, "p50": 560 }, "2025": { "n": 221, "p50": 955 }, "2026": { "n": 142, "p50": 649.01 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0007", "description": "CARGADOR DE DOSIMETROS", "priced_items": 48, "units": [ { "n": 39, "max": 117800.3, "min": 5.79, "p10": 174.336, "p50": 6075, "p90": 39756.4, "unidad": "PIEZA" }, { "n": 5, "max": 76670, "min": 84.5, "p10": 84.5, "p50": 112, "p90": 46046.8, "unidad": "SERVICIO" }, { "n": 4, "max": 676486.21, "min": 23879.46, "p10": 23962.431, "p50": 43548.215, "p90": 492422.467, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 1, "p50": 737 }, "2024": { "n": 21, "p50": 9707 }, "2025": { "n": 4, "p50": 9515.985 }, "2026": { "n": 22, "p50": 3203.095 } }, "refreshed_at": "2026-09-25T21:00:03.055Z" }, { "cucop_code": "25501-0077", "description": "FRASCO", "priced_items": 1085, "units": [ { "n": 1017, "max": 236206.9, "min": 0.16, "p10": 10, "p50": 185.08, "p90": 3599.4, "unidad": "PIEZA" }, { "n": 55, "max": 20078.83, "min": 3.95, "p10": 18, "p50": 360, "p90": 4443.944, "unidad": "UNIDAD" }, { "n": 8, "max": 146132, "min": 1660, "p10": 2157, "p50": 19799.03, "p90": 122882.242, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 411, "p50": 134 }, "2024": { "n": 298, "p50": 477.93 }, "2025": { "n": 196, "p50": 183.185 }, "2026": { "n": 180, "p50": 199.825 } }, "refreshed_at": "2026-09-22T21:45:17.601Z" }, { "cucop_code": "25501-0067", "description": "MARCADOR DE PESO MOLECULAR", "priced_items": 54, "units": [ { "n": 46, "max": 112425.3, "min": 23, "p10": 41, "p50": 1734.62, "p90": 8520.375, "unidad": "PIEZA" }, { "n": 4, "max": 23958.3, "min": 12008.58, "p10": 12008.58, "p50": 12647.29, "p90": 20756.61, "unidad": "MILILITRO" }, { "n": 3, "max": 3507, "min": 3049, "p10": 3076, "p50": 3184, "p90": 3442.4, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 19, "p50": 1241.28 }, "2024": { "n": 14, "p50": 2341.245 }, "2025": { "n": 13, "p50": 1232 }, "2026": { "n": 8, "p50": 7558.27 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0120", "description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "priced_items": 235, "units": [ { "n": 218, "max": 119560, "min": 70, "p10": 2133.332, "p50": 16775.36, "p90": 43309.494, "unidad": "PIEZA" }, { "n": 9, "max": 34154, "min": 6645, "p10": 8689, "p50": 14976, "p90": 29050, "unidad": "UNIDAD" }, { "n": 5, "max": 34353.94, "min": 230.55, "p10": 282.418, "p50": 404.72, "p90": 27868.316, "unidad": "METRO" } ], "price_by_year": { "2023": { "n": 70, "p50": 17769.5 }, "2024": { "n": 81, "p50": 17587 }, "2025": { "n": 57, "p50": 16610.07 }, "2026": { "n": 27, "p50": 3601.57 } }, "refreshed_at": "2026-09-18T22:38:31.345Z" }, { "cucop_code": "25501-0083", "description": "POLIMERO (PTFE, SEPTA, FERRULES)", "priced_items": 139, "units": [ { "n": 132, "max": 45450.62, "min": 15, "p10": 229.5, "p50": 2124.335, "p90": 12784.4, "unidad": "PIEZA" }, { "n": 5, "max": 21120, "min": 1559, "p10": 3415.4, "p50": 13400, "p90": 19192, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 41, "p50": 3895 }, "2024": { "n": 37, "p50": 2561.06 }, "2025": { "n": 37, "p50": 2257 }, "2026": { "n": 24, "p50": 1372.835 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25101-0037", "description": "REACTIVOS ANALITICOS", "priced_items": 44908, "units": [ { "n": 37743, "max": 280215502.56, "min": 0.53, "p10": 257, "p50": 3160, "p90": 19101.912, "unidad": "PIEZA" }, { "n": 3116, "max": 389753, "min": 2.25, "p10": 400, "p50": 2371.685, "p90": 18751.455, "unidad": "LITRO" }, { "n": 2930, "max": 1567806.8, "min": 1, "p10": 120, "p50": 3200, "p90": 17597.42, "unidad": "UNIDAD" }, { "n": 249, "max": 111832796, "min": 3.81, "p10": 885.8, "p50": 31540, "p90": 8964611.16, "unidad": "SERVICIO" }, { "n": 204, "max": 48058.42, "min": 140, "p10": 516.839, "p50": 15109.01, "p90": 33997.005, "unidad": "MILILITRO" }, { "n": 147, "max": 66620.51, "min": 0.75, "p10": 294.948, "p50": 1414, "p90": 7859.608, "unidad": "GRAMO" }, { "n": 142, "max": 68318.25, "min": 12.93, "p10": 72.992, "p50": 895.05, "p90": 5181.9, "unidad": "KILOGRAMO" }, { "n": 142, "max": 24971469.93, "min": 18, "p10": 1215.2, "p50": 65495.585, "p90": 457938.306, "unidad": "LOTE" }, { "n": 65, "max": 33900, "min": 208, "p10": 647.412, "p50": 2063.45, "p90": 5323.4, "unidad": "GALON" }, { "n": 59, "max": 120750, "min": 58.5, "p10": 112.396, "p50": 1561.88, "p90": 13849.984, "unidad": "TESLA" }, { "n": 58, "max": 21600, "min": 16.04, "p10": 22.329, "p50": 110.985, "p90": 691, "unidad": "METRO CUBICO" }, { "n": 28, "max": 12722.17, "min": 119, "p10": 698.229, "p50": 1903.5, "p90": 4866.035, "unidad": "MILIGRAMO" }, { "n": 25, "max": 103489.92, "min": 1617, "p10": 11250.8, "p50": 14200.9, "p90": 57843.788, "unidad": "KILOGRAMO POR HORA" } ], "price_by_year": { "2023": { "n": 14653, "p50": 2420 }, "2024": { "n": 13438, "p50": 3500 }, "2025": { "n": 8626, "p50": 4177.3 }, "2026": { "n": 8191, "p50": 2958 } }, "refreshed_at": "2026-09-24T05:35:01.565Z" }, { "cucop_code": "25101-0049", "description": "COMPUESTO QUIMICO", "priced_items": 9641, "units": [ { "n": 6803, "max": 446857.16, "min": 0.18, "p10": 210, "p50": 2220.54, "p90": 14850, "unidad": "PIEZA" }, { "n": 1458, "max": 234303.56, "min": 7.11, "p10": 262.741, "p50": 3321, "p90": 27897.261, "unidad": "LITRO" }, { "n": 417, "max": 107500, "min": 1.27, "p10": 13.99, "p50": 117.45, "p90": 1336.656, "unidad": "KILOGRAMO" }, { "n": 270, "max": 77586.21, "min": 72.08, "p10": 163.368, "p50": 2182.08, "p90": 12455.3, "unidad": "UNIDAD" }, { "n": 227, "max": 551727.59, "min": 46.64, "p10": 1238.41, "p50": 7942, "p90": 34884.178, "unidad": "LOTE" }, { "n": 225, "max": 28382.84, "min": 0.01, "p10": 0.6373, "p50": 830, "p90": 2675.328, "unidad": "GRAMO" }, { "n": 110, "max": 21415.86, "min": 0.01, "p10": 0.05, "p50": 119.92, "p90": 3655.8, "unidad": "MILILITRO" }, { "n": 79, "max": 179860, "min": 22, "p10": 274, "p50": 2340, "p90": 19000, "unidad": "METRO CUBICO" }, { "n": 26, "max": 16211, "min": 73, "p10": 120, "p50": 303.5, "p90": 2500.125, "unidad": "GALON" }, { "n": 17, "max": 35301000, "min": 95, "p10": 408, "p50": 77586.21, "p90": 8725440.398, "unidad": "SERVICIO" }, { "n": 3, "max": 7864, "min": 2271.25, "p10": 2292.4, "p50": 2377, "p90": 6766.6, "unidad": "MILIGRAMO" }, { "n": 3, "max": 13.99, "min": 13.99, "p10": 13.99, "p50": 13.99, "p90": 13.99, "unidad": "KILOMETRO" } ], "price_by_year": { "2023": { "n": 4558, "p50": 3176.215 }, "2024": { "n": 2176, "p50": 1743 }, "2025": { "n": 1994, "p50": 1379.41 }, "2026": { "n": 913, "p50": 1092 } }, "refreshed_at": "2026-09-25T21:00:03.055Z" }, { "cucop_code": "25501-0071", "description": "PLACA", "priced_items": 603, "units": [ { "n": 534, "max": 1057257.48, "min": 10, "p10": 186.2, "p50": 2586.4, "p90": 18010, "unidad": "PIEZA" }, { "n": 55, "max": 19974, "min": 180, "p10": 914.994, "p50": 1980, "p90": 6121.52, "unidad": "UNIDAD" }, { "n": 12, "max": 420267.58, "min": 1862.57, "p10": 6736.405, "p50": 97403.615, "p90": 413283.95, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 242, "p50": 2113.01 }, "2024": { "n": 196, "p50": 3455.475 }, "2025": { "n": 102, "p50": 2279 }, "2026": { "n": 63, "p50": 2060 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0103", "description": "PAPEL PARAFILM", "priced_items": 398, "units": [ { "n": 368, "max": 253260, "min": 1, "p10": 187, "p50": 902, "p90": 4050.035, "unidad": "PIEZA" }, { "n": 27, "max": 4016, "min": 40, "p10": 77.324, "p50": 654.4, "p90": 1800, "unidad": "UNIDAD" } ], "price_by_year": { "2023": { "n": 96, "p50": 952.5 }, "2024": { "n": 104, "p50": 958 }, "2025": { "n": 95, "p50": 784 }, "2026": { "n": 103, "p50": 800 } }, "refreshed_at": "2026-09-21T20:00:02.331Z" }, { "cucop_code": "25501-0057", "description": "TAPA PARA CRISOL DE TODO TIPO DE MATERIAL", "priced_items": 104, "units": [ { "n": 103, "max": 15939.25, "min": 3, "p10": 12.968, "p50": 683.24, "p90": 5053.344, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 31, "p50": 554.28 }, "2024": { "n": 53, "p50": 834 }, "2025": { "n": 14, "p50": 590 }, "2026": { "n": 6, "p50": 1085 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0061", "description": "ACRODISCOS", "priced_items": 87, "units": [ { "n": 86, "max": 57261.22, "min": 1, "p10": 2043.32, "p50": 7000, "p90": 26935.215, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 22, "p50": 8846.5 }, "2024": { "n": 28, "p50": 13000 }, "2025": { "n": 10, "p50": 10739 }, "2026": { "n": 27, "p50": 2483 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0087", "description": "ELECTRODO DE REFERENCIA", "priced_items": 148, "units": [ { "n": 146, "max": 37965.52, "min": 3.57, "p10": 981.96, "p50": 5599.78, "p90": 17380.565, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 46, "p50": 4654.5 }, "2024": { "n": 42, "p50": 4501.405 }, "2025": { "n": 31, "p50": 6993.5 }, "2026": { "n": 29, "p50": 8534 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0122", "description": "ACCESORIOS PARA BUTIROMETRO", "priced_items": 38, "units": [ { "n": 38, "max": 36021.23, "min": 3.54, "p10": 88.724, "p50": 844.945, "p90": 15313.8446, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 5, "p50": 652.4 }, "2024": { "n": 18, "p50": 684.195 }, "2025": { "n": 11, "p50": 954 }, "2026": { "n": 4, "p50": 1351.94 } }, "refreshed_at": "2026-09-18T22:38:31.345Z" }, { "cucop_code": "25501-0058", "description": "BASE SOPORTE DE MATRACES", "priced_items": 26, "units": [ { "n": 26, "max": 27390, "min": 52.19, "p10": 160.515, "p50": 1895.75, "p90": 17924, "unidad": "PIEZA" } ], "price_by_year": { "2023": { "n": 17, "p50": 1965.5 }, "2024": { "n": 5, "p50": 5989.23 }, "2025": { "n": 1, "p50": 861 }, "2026": { "n": 3, "p50": 208.79 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0008", "description": "CONO REVESTIMIENTO", "priced_items": 47, "units": [ { "n": 41, "max": 54504.33, "min": 30.78, "p10": 43.1, "p50": 1091.68, "p90": 37114, "unidad": "PIEZA" }, { "n": 3, "max": 1376, "min": 690.66, "p10": 749.528, "p50": 985, "p90": 1297.8, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 11, "p50": 751.58 }, "2024": { "n": 18, "p50": 1038.34 }, "2025": { "n": 12, "p50": 5870.5 }, "2026": { "n": 6, "p50": 460 } }, "refreshed_at": "2026-09-18T22:38:28.375Z" } ], "suppliers": [ { "slug": "agilent-technologies-mexico", "name": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "total_contracts": 236, "total_awarded_amount": "200198128.45", "median_amount": "206559.16", "distinct_buyers": 40, "first_contract_at": "2023-02-16T00:00:00.000Z", "last_contract_at": "2026-09-21T00:00:00.000Z", "with_this_buyer": { "contracts": 14, "amount": "26123003.79" }, "refreshed_at": "2026-09-25T21:00:03.055Z" }, { "slug": "analitek", "name": "ANALITEK SA DE CV", "total_contracts": 53, "total_awarded_amount": "26019775.96", "median_amount": "185650.43", "distinct_buyers": 12, "first_contract_at": "2023-01-27T00:00:00.000Z", "last_contract_at": "2024-06-26T00:00:00.000Z", "with_this_buyer": { "contracts": 15, "amount": "16863885.49" }, "refreshed_at": "2026-09-17T00:43:15.210Z" }, { "slug": "applied-biosystems-de-mexico", "name": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "total_contracts": 222, "total_awarded_amount": "205941008.89", "median_amount": "190943.80", "distinct_buyers": 28, "first_contract_at": "2023-01-01T00:00:00.000Z", "last_contract_at": "2026-09-25T00:00:00.000Z", "with_this_buyer": { "contracts": 35, "amount": "78443240.76" }, "refreshed_at": "2026-09-25T05:35:01.354Z" }, { "slug": "biomerieux-mexico", "name": "BIOMERIEUX MEXICO SA DE CV", "total_contracts": 69, "total_awarded_amount": "154945944.19", "median_amount": "502860.00", "distinct_buyers": 12, "first_contract_at": "2023-03-01T00:00:00.000Z", "last_contract_at": "2026-06-11T00:00:00.000Z", "with_this_buyer": { "contracts": 12, "amount": "11814943.08" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "cientifica-senna", "name": "CIENTIFICA SENNA SA DE CV", "total_contracts": 150, "total_awarded_amount": "47497739.02", "median_amount": "70203.59", "distinct_buyers": 30, "first_contract_at": "2023-02-24T00:00:00.000Z", "last_contract_at": "2026-09-15T00:00:00.000Z", "with_this_buyer": { "contracts": 12, "amount": "5371681.73" }, "refreshed_at": "2026-09-17T00:43:15.210Z" }, { "slug": "deteccion-molecular-y-asesoria-analitica", "name": "DETECCION MOLECULAR Y ASESORIA ANALITICA SA DE CV", "total_contracts": 88, "total_awarded_amount": "30664802.48", "median_amount": "114503.11", "distinct_buyers": 14, "first_contract_at": "2023-04-24T00:00:00.000Z", "last_contract_at": "2025-12-02T00:00:00.000Z", "with_this_buyer": { "contracts": 12, "amount": "15020037.38" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "dicmalab", "name": "DICMALAB SA DE CV", "total_contracts": 3, "total_awarded_amount": "1089226.08", "median_amount": "212280.00", "distinct_buyers": 1, "first_contract_at": "2023-10-18T00:00:00.000Z", "last_contract_at": "2025-04-10T00:00:00.000Z", "with_this_buyer": { "contracts": 3, "amount": "1089226.08" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "hygiena-mexico", "name": "HYGIENA MEXICO SA DE CV", "total_contracts": 14, "total_awarded_amount": "19612663.19", "median_amount": "201823.47", "distinct_buyers": 1, "first_contract_at": "2023-03-23T00:00:00.000Z", "last_contract_at": "2025-04-10T00:00:00.000Z", "with_this_buyer": { "contracts": 14, "amount": "19612663.19" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "motibus", "name": "MOTIBUS SA DE CV", "total_contracts": 4, "total_awarded_amount": "5616998.40", "median_amount": "1173664.80", "distinct_buyers": 1, "first_contract_at": "2023-04-27T00:00:00.000Z", "last_contract_at": "2025-04-10T00:00:00.000Z", "with_this_buyer": { "contracts": 4, "amount": "5616998.4" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "omg-international", "name": "OMG INTERNATIONAL SA DE CV", "total_contracts": 45, "total_awarded_amount": "27304902.13", "median_amount": "93823.93", "distinct_buyers": 4, "first_contract_at": "2023-02-13T00:00:00.000Z", "last_contract_at": "2026-09-15T00:00:00.000Z", "with_this_buyer": { "contracts": 3, "amount": "1223679.18" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "quadrix", "name": "QUADRIX SA DE CV", "total_contracts": 17, "total_awarded_amount": "7918551.81", "median_amount": "133050.06", "distinct_buyers": 4, "first_contract_at": "2023-02-10T00:00:00.000Z", "last_contract_at": "2025-12-26T00:00:00.000Z", "with_this_buyer": { "contracts": 13, "amount": "7481207.3" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "uniparts", "name": "UNIPARTS SA DE CV", "total_contracts": 198, "total_awarded_amount": "38076889.14", "median_amount": "66347.69", "distinct_buyers": 33, "first_contract_at": "2023-02-03T00:00:00.000Z", "last_contract_at": "2025-12-16T00:00:00.000Z", "with_this_buyer": { "contracts": 12, "amount": "11351646.93" }, "refreshed_at": "2026-09-16T00:56:30.797Z" }, { "slug": "waters", "name": "WATERS SA DE CV", "total_contracts": 170, "total_awarded_amount": "136386848.82", "median_amount": "260082.21", "distinct_buyers": 27, "first_contract_at": "2023-02-01T00:00:00.000Z", "last_contract_at": "2026-10-01T00:00:00.000Z", "with_this_buyer": { "contracts": 14, "amount": "59562369.59" }, "refreshed_at": "2026-09-25T20:45:03.663Z" } ], "buyer": { "slug": "senasica", "name": "SERVICIO NACIONAL DE SANIDAD, INOCUIDAD Y CALIDAD AGROALIMENTARIA", "total_procedures": 504, "distinct_suppliers": 321, "procedures_by_type": { "LICITACIÓN PÚBLICA": 103, "ADJUDICACIÓN DIRECTA": 283, "INVITACIÓN A CUANDO MENOS TRES PERSONAS": 115, "CONTRATO ESPECÍFICO DERIVADO DE ACUERDO MARCO": 3 }, "refreshed_at": "2026-09-24T00:15:06.112Z" } }, "alternates": [], "similar": [ { "numero_procedimiento": "aa-08-b00-008b00001-n-57-2023", "nombre_procedimiento": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "dependencia": "SENASICA", "siglas": "SENASICA", "score": 0.030922411029179586, "anio_ejercicio": 2023, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2023-05-29T12:11:39.000Z", "ganador": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "ganador_slug": "agilent-technologies-mexico", "ganador_rfc_type": null, "ganadores": "12", "monto_mxn": "16222570.90" }, { "numero_procedimiento": "aa-16-rjj-016rjj001-n-32-2024", "nombre_procedimiento": "ADQUISICIÓN DE CONSUMIBLES, MATERIALES Y REACTIVOS QUÍMICOS PARA LOS LABORATORIO", "dependencia": "INECC", "siglas": "INECC", "score": 0.12605397390675233, "anio_ejercicio": 2024, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2025-07-03T10:48:21.000Z", "ganador": "ACCESORIOS PARA LABORATORIOS SA DE CV", "ganador_slug": "accesorios-para-laboratorios", "ganador_rfc_type": null, "ganadores": "14", "monto_mxn": "6170626.15" }, { "numero_procedimiento": "aa-08-b00-008b00001-n-112-2025", "nombre_procedimiento": "PRODUCTOS QUÍMICOS BÁSICOS Y MATERIALES PARA LABORATORIO CENAPA MARCAS IDT", "dependencia": "SENASICA", "siglas": "SENASICA", "score": 0.15037694864685114, "anio_ejercicio": 2025, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2025-04-29T14:07:23.000Z", "ganador": "UNIPARTS SA DE CV", "ganador_slug": "uniparts", "ganador_rfc_type": null, "ganadores": "2", "monto_mxn": "2508784.53" }, { "numero_procedimiento": "aa-08-b00-008b00001-n-64-2023", "nombre_procedimiento": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CNRF", "dependencia": "SENASICA", "siglas": "SENASICA", "score": 0.15929757599247685, "anio_ejercicio": 2023, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2023-06-12T16:46:32.000Z", "ganador": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "ganador_slug": "applied-biosystems-de-mexico", "ganador_rfc_type": null, "ganadores": "7", "monto_mxn": "4592784.91" }, { "numero_procedimiento": "aa-16-rjj-016rjj001-n-45-2025", "nombre_procedimiento": "ADQUISICIÓN DE MATERIALES Y SUSTANCIAS PARA LA IMPLEMENTACIÓN Y REALIZACIÓN", "dependencia": "INSTITUTO NACIONAL DE ECOLOGIA Y CAMBIO CLIMATICO", "siglas": "INECC", "score": 0.16070337646870492, "anio_ejercicio": 2025, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2025-09-04T19:55:15.000Z", "ganador": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "ganador_slug": "agilent-technologies-mexico", "ganador_rfc_type": null, "ganadores": "6", "monto_mxn": "1014740.55" }, { "numero_procedimiento": "aa-08-b00-008b00001-n-42-2024", "nombre_procedimiento": "ADQUISICIÓN DE SUSTANCIAS QUÍMICAS PARA EL (CNRIBA) 2024", "dependencia": "SENASICA", "siglas": "SENASICA", "score": 0.1607485913784017, "anio_ejercicio": 2024, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2024-04-11T10:17:30.000Z", "ganador": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "ganador_slug": "agilent-technologies-mexico", "ganador_rfc_type": null, "ganadores": "12", "monto_mxn": "17913860.57" } ] }