{ "html_url": "https://postor.com.mx/adjudicacion/aa-08-b00-008b00001-n-112-2025", "canonical": "https://postor.com.mx/adjudicacion/aa-08-b00-008b00001-n-112-2025", "id": "a6e5b4070085442ea53cce4845c62101", "procedure_number": "AA-08-B00-008B00001-N-112-2025", "file_number": "E-2025-00033899", "title": "PRODUCTOS QUÍMICOS BÁSICOS Y MATERIALES PARA LABORATORIO CENAPA MARCAS IDT", "description": { "short": "No existen bienes alternativos o sustitutos, Único Oferente, Derechos exclusivos (patentes, licencias, derechos de autor u otros derechos exclusivos), o por obras de arte.", "detailed": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS BÁSICOS Y MATERIALES ACCESORIOS Y SUMINISTROS DE LABORATORIO, PARA EL CENTRO NACIONAL DE REFERENCIA EN PARASITOLOGÍA ANIMAL Y TECNOLOGÍA ANALÍTICA (CENAPA) MARCAS IDT Y PROMEGA" }, "lifecycle": { "section": "concluido", "source_status": "ADJUDICADO", "moved_at": null }, "buyer": { "agency": "SENASICA", "acronym": "SENASICA", "branch": "08 - AGRICULTURA Y DESARROLLO RURAL", "buying_unit": "DIRECCIÓN DE RECURSOS MATERIALES Y SERVICIOS GENERALES", "requesting_unit": null, "requesting_group": "DIRECCIÓN DE RECURSOS MATERIALES Y SERVICIOS GENERALES", "entity": "TESORERÍA DE LA FEDERACIÓN", "slug": "senasica", "unit_slug": "direccion-de-recursos-materiales-y-servicios-generales-008b00001" }, "classification": { "procedure_type": "ADJUDICACIÓN DIRECTA", "contracting_type": "ADQUISICIONES", "publication_type": null, "character": "NACIONAL", "fiscal_year": 2025, "law": "LEY DE ADQUISICIONES, ARRENDAMIENTOS Y SERVICIOS DEL SECTOR PÚBLICO", "legal_basis_id": "22", "exception_basis": "Art. 41 fr. I", "internal_control_number": "PRODUCTOS QUÍMICOS BÁSICOS Y MATERIALES PARA LABORATORIO CENAPA MARCAS IDT", "supply_source_number": null }, "schedule": { "published_at": "2025-04-29T20:07:23.000Z", "clarification_meeting_at": null, "clarification_questions_deadline_at": null, "clarification_responses_deadline_at": null, "bid_opening_at": null, "award_at": null, "estimated_contract_at": "2025-04-10T06:00:00.000Z", "site_visit_at": null, "estimated_work_start_at": null }, "locations": { "state_id": "7", "state": "CIUDAD DE MÉXICO", "bid_opening": null, "award": null, "clarification_meeting": null, "site_visit": null, "work_site": null }, "estimated_value": { "minimum": null, "maximum": null, "currency": "MXN", "updated_at": null }, "financial_terms": { "currency": "MXN", "advance_percentage": "0", "supplier_percentage": "10", "payment_method": "transferencia Electrónica", "credit_condition": null, "payment_conditions": null, "financing_organization": null }, "evaluation": { "criterion": "BINARIO", "technical_points": null, "economic_points": null }, "guarantees": { "performance_required": true, "goods_or_services_required": false, "amount_percentage": null, "delivery_days": "10", "term_months": null, "other_insurance_required": false, "other_insurance_description": null, "performance_reduction": null }, "participation": { "method": null, "joint": false, "msme_only": false, "social_witness": false, "multi_year": false, "open_contract": false, "consolidated_purchase": false, "external_credit": false, "simultaneous_supply": false, "subcontracting": null, "emergency": false, "proposal_language": "idioma data", "no_joint_participation_justification": null }, "execution": { "site_visit_required": null, "duration_days": null, "procurement_term": "Normal", "subcontracted_work": null, "deadline_justification": null }, "lots": [ { "number": "1", "name": "PARTIDA SOLA", "description": "PARTIDA SOLA", "requirement_group_id": "1", "items": [ { "number": "1", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "AGUA LIBRE DE NUCLEASAS MARCA PROMEGA CATALOGO P1193 FRASCO 50 ML LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "2", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "ABPV-PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/AT AGT TAA AAC AGC TTT TCA CAC TGG /3BHQ_1/ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "3", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "BLUE ORANGE LOADING DYE 6X MARCA PROMEGA CATALOGO G1881 FRASCO 3 ML LITRO", "requested_quantity": "4", "minimum_quantity": "4", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "4", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "CTRL IHHNV///MINIGENE 25-250 PB///GCACATCACATACTCCGGACACCCAACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCC GAAGCTGAAG MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "5", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "EDTA 0.5 M MARCA PROMEGA CATALOGO V4231 FRASCO 100 ML LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "6", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "NPI-S /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ///56-FAM/TA CAT AGG C/ZEN/A AAA CCA AAG GAG ACA C/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI) MARCA IDT CATALOGO SINTESIS PIEZA", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "7", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "GBLOCKS GENE FRAGMENTS MARCA IDT CATALOGO GBLOCKS-1 KIT LITRO", "requested_quantity": "5", "minimum_quantity": "5", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "8", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "GO TAQ LONG PCR MASTER MIX MARCA PROMEGA CATALOGO M4021 KIT 100 REACCIONES LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "9", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SISTEMA COMERCIAL PARA LA PURIFICACIÓN A PARTIR DE SANGRE MARCA PROMEGA CATALOGO A5081 KIT LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "10", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "NHP FLGE3QF / 250 NMOLE DNA OLIGO / HPLC / AACACCCTGTCTCCCCAATTC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTOMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "11", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SISTEMA DE PURIFICACÍON DE ADN MARCA PROMEGA CATALOGO A1120 KIT 100 REACCIONES LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "12", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "NHP FLGE3QR / 250 NMOLE DNA OLIGO / HPLC / CCAGCCTTGGACAAACACCTT. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTOMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "13", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "NPI-FW /// 100 NMOLE DNA OLIGO /// HPLC /// GTT GAT MMA STA CAC CGG AG. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "14", "cucop_code": "25101-0037", "specific_item_code": "25101", "cucop_description": "REACTIVOS ANALITICOS", "description": "SOLUCIÓN MAESTRA PARA PCR 2X CONTIENE TODOS LOS REACTIVOS PARA LA REACCIÓN EXCEPTO INICIADORES Y ADN BLANCO PARA 1000 REACCIONES (PCR MASTER MIX) MARCA PROMEGA CATALOGO M7505 FRASCO 25 ML LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "15", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "NPI-RV /// 100 NMOLE DNA OLIGO /// HPLC /// AGG TCH CKT ATG AAG GAG TC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "16", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "NPI-S /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ///56-FAM/TA CAT AGG C/ZEN/A AAA CCA AAG GAG ACA C/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI) MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "17", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: HPB F CGTTCACGGGCCTTGTACAC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "18", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: HPB R GCTCATCGCCTTAAAGAAAAGATAA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "19", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: IHHNV FW TACTCCGGACACCCAACCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "20", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: IHHNV RV GGCTCTGGCAGCAAAGGTAA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "21", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: OSHV F GTCGCATCTTTGGATTTAACAA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "22", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: OSHV R ACTGGGATCCGACTGACAAC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "23", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: PVNV F TGGGAACGCTATAAGTGGTTATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "24", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: PVNV R ATCGTCGAGAGGATCAGTATCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "25", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: RUM16S-FW: TGGTTGTCCAGAAGATG ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "26", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: RUM16S-RV: ACTTTTAAARMTACAGTGRRATTTATTT ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "27", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: SHRIMP F AAGTCTAGCCTGCCCACTG ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "28", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: SHRIMP R GTCCAACCATTCATACAAGCC ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "3", "minimum_quantity": "3", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "29", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: VHS-FW: ATGAGGCAGGTGTCGGAGG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "30", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: VHS-RV: TGTAGTAGGACTCTCCCAGCATCC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "31", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: YHV F CGTCCCGGCAATTGTGATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "32", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "OLIGONUCLEOTIDO: YHV R CCAGTGACGTTCGATGCAATA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "33", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA TSV S: CAGCACTGACGCACAATATTCGAGCATC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "34", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA: BDLOOPP: 6FAM-ACCAGACATAGAGCTACAATCCTCGCCTATTTG-3IABKFQ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "35", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA: VHS-S: FAM/TACGCCATCATGATGAGT/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "36", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA: HPB S CCGCCCGTCAAGCCATGGAA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "37", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA: IHNV-S TGAGACTGAGCGGGACA/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "38", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA: IMNV P CCACCTTTACTTTCAATACTACATCATCCCCGG ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "39", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA: NHP FLGE3QS CGCCCCAAAGCATGCCGC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "40", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA: OSHV P TGCCCCTGTCATCTTGAGGTATAGACAATC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "41", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA: PVNV P TTACGTCCCAGCGGTGCCAAATA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "42", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA: SHRIMP P AGACTAATGATTATGCTACCTTCGCACGGT ESCALA: 1 µM DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: CY5/TAO/3’ IB RQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "43", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "SONDA: YHV P CCATCAAAGCTCTCAACGCCGTCA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "1", "minimum_quantity": "1", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "44", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "TSV F / 1 UM DNA OLIGO / HPLC /TTGGGCACCAAACGACATT. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "45", "cucop_code": "25101-0049", "specific_item_code": "25101", "cucop_description": "COMPUESTO QUIMICO", "description": "TSV R / 1 UM DNA OLIGO / HPLC /GGGAGCTTAAACTGGACACACTGT. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "LITRO", "minimum_amount": null, "maximum_amount": null, "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "46", "cucop_code": "25501-0048", "specific_item_code": "25501", "cucop_description": "TUBO MUESTRADOR", "description": "COLLECTION TUBES MARCA PROMEGA CATALOGO A130B PAQUETE 250 PIEZA PIEZA", "requested_quantity": "83", "minimum_quantity": "83", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "47", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "MINICOLUMNS WIZARD SV GEL AND PCR CLEAN-UP SYSTEM MARCA PROMEGA CATALOGO A129B PAQUETE 250 PIEZA PIEZA", "requested_quantity": "60", "minimum_quantity": "60", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "48", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "MINICOLUMNS WIZARD Y COLLECTION TUBES MARCA PROMEGA CATALOGO A1460 PAQUETE PIEZA", "requested_quantity": "21", "minimum_quantity": "21", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "49", "cucop_code": "25501-0120", "specific_item_code": "25501", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "description": "WIZARD SV GEL MINICOLUMNS MARCA PROMEGA CATALOGO A9281 KIT PARA 50 REACCIONES PIEZA", "requested_quantity": "2", "minimum_quantity": "2", "maximum_quantity": null, "unit": "PIEZA", "minimum_amount": null, "maximum_amount": null, "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] } ], "budget_items": [ { "code": "25101", "description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "code": "25501", "description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ], "awards": [ { "id": "C-2025-00036644", "internal_reference": "A-047/2025", "title": "PRODUCTOS QUÍMICOS BÁSICOS Y MATERIALES PARA LABORATORIO CENAPA MARCAS IDT", "status": "PUBLICADO", "contractor": { "name": "UNIPARTS SA DE CV", "normalized_name": "UNIPARTS", "rfc_type": null, "slug": "uniparts" }, "contract_period": { "published_at": "2025-04-29T20:07:23.000Z", "starts_at": "2025-04-10T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "527913.89", "tax": "84466.22", "total": "612380.11", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25101-0037", "description": "AGUA LIBRE DE NUCLEASAS MARCA PROMEGA CATALOGO P1193 FRASCO 50 ML LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "1264.9", "subtotal": "2529.8", "tax": "404.77", "other_taxes": null, "total": "2934.57", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "ABPV-PROBE /// 100 NM PRIMETIME® 5´ 6-FAM / 3´ BHQ-1 /// HPLC /// 56-FAM/AT AGT TAA AAC AGC TTT TCA CAC TGG /3BHQ_1/ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "10609.52", "subtotal": "10609.52", "tax": "1697.52", "other_taxes": null, "total": "12307.04", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "BLUE ORANGE LOADING DYE 6X MARCA PROMEGA CATALOGO G1881 FRASCO 3 ML LITRO", "unit": "LITRO", "requested_quantity": "4", "awarded_quantity": null, "unit_price": "974.59", "subtotal": "3898.36", "tax": "623.74", "other_taxes": null, "total": "4522.1", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "CTRL IHHNV///MINIGENE 25-250 PB///GCACATCACATACTCCGGACACCCAACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCC GAAGCTGAAG MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8841.26", "subtotal": "8841.26", "tax": "1414.6", "other_taxes": null, "total": "10255.86", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "EDTA 0.5 M MARCA PROMEGA CATALOGO V4231 FRASCO 100 ML LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "482.89", "subtotal": "482.89", "tax": "77.26", "other_taxes": null, "total": "560.15", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "NPI-S /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ///56-FAM/TA CAT AGG C/ZEN/A AAA CCA AAG GAG ACA C/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI) MARCA IDT CATALOGO SINTESIS PIEZA", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "8841.26", "subtotal": "8841.26", "tax": "1414.6", "other_taxes": null, "total": "10255.86", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "GBLOCKS GENE FRAGMENTS MARCA IDT CATALOGO GBLOCKS-1 KIT LITRO", "unit": "LITRO", "requested_quantity": "5", "awarded_quantity": null, "unit_price": "5759.45", "subtotal": "28797.25", "tax": "4607.56", "other_taxes": null, "total": "33404.81", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "GO TAQ LONG PCR MASTER MIX MARCA PROMEGA CATALOGO M4021 KIT 100 REACCIONES LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "10748.16", "subtotal": "21496.32", "tax": "3439.41", "other_taxes": null, "total": "24935.73", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SISTEMA COMERCIAL PARA LA PURIFICACIÓN A PARTIR DE SANGRE MARCA PROMEGA CATALOGO A5081 KIT LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13261.97", "subtotal": "13261.97", "tax": "2121.91", "other_taxes": null, "total": "15383.88", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "NHP FLGE3QF / 250 NMOLE DNA OLIGO / HPLC / AACACCCTGTCTCCCCAATTC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTOMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3674.16", "subtotal": "3674.16", "tax": "587.87", "other_taxes": null, "total": "4262.03", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SISTEMA DE PURIFICACÍON DE ADN MARCA PROMEGA CATALOGO A1120 KIT 100 REACCIONES LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "4762.37", "subtotal": "9524.74", "tax": "1523.96", "other_taxes": null, "total": "11048.7", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "NHP FLGE3QR / 250 NMOLE DNA OLIGO / HPLC / CCAGCCTTGGACAAACACCTT. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTOMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3674.16", "subtotal": "3674.16", "tax": "587.87", "other_taxes": null, "total": "4262.03", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "NPI-FW /// 100 NMOLE DNA OLIGO /// HPLC /// GTT GAT MMA STA CAC CGG AG. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2208.87", "subtotal": "2208.87", "tax": "353.42", "other_taxes": null, "total": "2562.29", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0037", "description": "SOLUCIÓN MAESTRA PARA PCR 2X CONTIENE TODOS LOS REACTIVOS PARA LA REACCIÓN EXCEPTO INICIADORES Y ADN BLANCO PARA 1000 REACCIONES (PCR MASTER MIX) MARCA PROMEGA CATALOGO M7505 FRASCO 25 ML LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "30198.53", "subtotal": "30198.53", "tax": "4831.76", "other_taxes": null, "total": "35030.29", "cucop_description": "REACTIVOS ANALITICOS", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "NPI-RV /// 100 NMOLE DNA OLIGO /// HPLC /// AGG TCH CKT ATG AAG GAG TC. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "2208.87", "subtotal": "2208.87", "tax": "353.42", "other_taxes": null, "total": "2562.29", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "NPI-S /// 250 NM PRIMETIME® 5´ 6-FAM™/ZEN™/3´ IB®FQ /// HPLC ///56-FAM/TA CAT AGG C/ZEN/A AAA CCA AAG GAG ACA C/3IABKFQ/. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS Y ELECTROSPRAY (ESI) MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "13565.02", "subtotal": "13565.02", "tax": "2170.4", "other_taxes": null, "total": "15735.42", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: HPB F CGTTCACGGGCCTTGTACAC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3645", "subtotal": "3645", "tax": "583.2", "other_taxes": null, "total": "4228.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: HPB R GCTCATCGCCTTAAAGAAAAGATAA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "3790.8", "subtotal": "7581.6", "tax": "1213.06", "other_taxes": null, "total": "8794.66", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: IHHNV FW TACTCCGGACACCCAACCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3615.84", "subtotal": "3615.84", "tax": "578.53", "other_taxes": null, "total": "4194.37", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: IHHNV RV GGCTCTGGCAGCAAAGGTAA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3645", "subtotal": "3645", "tax": "583.2", "other_taxes": null, "total": "4228.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: OSHV F GTCGCATCTTTGGATTTAACAA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3703.32", "subtotal": "3703.32", "tax": "592.53", "other_taxes": null, "total": "4295.85", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: OSHV R ACTGGGATCCGACTGACAAC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3645", "subtotal": "3645", "tax": "583.2", "other_taxes": null, "total": "4228.2", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: PVNV F TGGGAACGCTATAAGTGGTTATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3732.48", "subtotal": "3732.48", "tax": "597.2", "other_taxes": null, "total": "4329.68", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: PVNV R ATCGTCGAGAGGATCAGTATCA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3703.32", "subtotal": "3703.32", "tax": "592.53", "other_taxes": null, "total": "4295.85", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: RUM16S-FW: TGGTTGTCCAGAAGATG ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "5693.98", "subtotal": "5693.98", "tax": "911.04", "other_taxes": null, "total": "6605.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: RUM16S-RV: ACTTTTAAARMTACAGTGRRATTTATTT ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6378.26", "subtotal": "12756.52", "tax": "2041.04", "other_taxes": null, "total": "14797.56", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: SHRIMP F AAGTCTAGCCTGCCCACTG ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5818.39", "subtotal": "17455.17", "tax": "2792.83", "other_taxes": null, "total": "20248", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: SHRIMP R GTCCAACCATTCATACAAGCC ESCALA: 1 µM DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "3", "awarded_quantity": null, "unit_price": "5942.81", "subtotal": "17828.43", "tax": "2852.55", "other_taxes": null, "total": "20680.98", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: VHS-FW: ATGAGGCAGGTGTCGGAGG ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3615.84", "subtotal": "3615.84", "tax": "578.53", "other_taxes": null, "total": "4194.37", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: VHS-RV: TGTAGTAGGACTCTCCCAGCATCC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3761.64", "subtotal": "3761.64", "tax": "601.86", "other_taxes": null, "total": "4363.5", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: YHV F CGTCCCGGCAATTGTGATC ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3615.84", "subtotal": "3615.84", "tax": "578.53", "other_taxes": null, "total": "4194.37", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "OLIGONUCLEOTIDO: YHV R CCAGTGACGTTCGATGCAATA ESCALA: 250NMOLE DNA OLIGO PURIFICACIÓN: HPLC MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "3674.16", "subtotal": "3674.16", "tax": "587.87", "other_taxes": null, "total": "4262.03", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA TSV S: CAGCACTGACGCACAATATTCGAGCATC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "16838.81", "subtotal": "33677.62", "tax": "5388.42", "other_taxes": null, "total": "39066.04", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA: BDLOOPP: 6FAM-ACCAGACATAGAGCTACAATCCTCGCCTATTTG-3IABKFQ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16838.81", "subtotal": "16838.81", "tax": "2694.21", "other_taxes": null, "total": "19533.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA: VHS-S: FAM/TACGCCATCATGATGAGT/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16838.81", "subtotal": "16838.81", "tax": "2694.21", "other_taxes": null, "total": "19533.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA: HPB S CCGCCCGTCAAGCCATGGAA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16838.81", "subtotal": "16838.81", "tax": "2694.21", "other_taxes": null, "total": "19533.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA: IHNV-S TGAGACTGAGCGGGACA/ ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16838.81", "subtotal": "16838.81", "tax": "2694.21", "other_taxes": null, "total": "19533.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA: IMNV P CCACCTTTACTTTCAATACTACATCATCCCCGG ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16838.81", "subtotal": "16838.81", "tax": "2694.21", "other_taxes": null, "total": "19533.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA: NHP FLGE3QS CGCCCCAAAGCATGCCGC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16838.81", "subtotal": "16838.81", "tax": "2694.21", "other_taxes": null, "total": "19533.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA: OSHV P TGCCCCTGTCATCTTGAGGTATAGACAATC ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16838.81", "subtotal": "16838.81", "tax": "2694.21", "other_taxes": null, "total": "19533.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA: PVNV P TTACGTCCCAGCGGTGCCAAATA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16838.81", "subtotal": "16838.81", "tax": "2694.21", "other_taxes": null, "total": "19533.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA: SHRIMP P AGACTAATGATTATGCTACCTTCGCACGGT ESCALA: 1 µM DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: CY5/TAO/3’ IB RQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "26652.61", "subtotal": "53305.22", "tax": "8528.84", "other_taxes": null, "total": "61834.06", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "SONDA: YHV P CCATCAAAGCTCTCAACGCCGTCA ESCALA: 250NMOLE DNA OLIGO SERVICIO: ANALYTICAL RP-HPLC 5’ DYE/ 3’ QUENCHER: 6-FAM/ZEN/3’ IB FQ MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "1", "awarded_quantity": null, "unit_price": "16838.81", "subtotal": "16838.81", "tax": "2694.21", "other_taxes": null, "total": "19533.02", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "TSV F / 1 UM DNA OLIGO / HPLC /TTGGGCACCAAACGACATT. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "5818.39", "subtotal": "11636.78", "tax": "1861.88", "other_taxes": null, "total": "13498.66", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" }, { "number": "0", "cucop_code": "25101-0049", "description": "TSV R / 1 UM DNA OLIGO / HPLC /GGGAGCTTAAACTGGACACACTGT. TAMAÑO Y SECUENCIA VERIFICADOS POR ESPECTROMETRÍA DE MASAS MARCA IDT CATALOGO SINTESIS PIEZA LITRO", "unit": "LITRO", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "6129.43", "subtotal": "12258.86", "tax": "1961.42", "other_taxes": null, "total": "14220.28", "cucop_description": "COMPUESTO QUIMICO", "partida_code": "25101", "partida_description": "PRODUCTOS QUÍMICOS BÁSICOS" } ] }, { "id": "C-2025-00036646", "internal_reference": "A-056/2025", "title": "PRODUCTOS QUÍMICOS BÁSICOS Y MATERIALES PARA LABORATORIO CENAPA MARCAS IDT", "status": "PUBLICADO", "contractor": { "name": "UNIPARTS SA DE CV", "normalized_name": "UNIPARTS", "rfc_type": null, "slug": "uniparts" }, "contract_period": { "published_at": "2025-04-29T20:09:50.000Z", "starts_at": "2025-04-10T06:00:00.000Z", "ends_at": "2025-12-31T06:00:00.000Z" }, "value": { "subtotal": "1634831.4", "tax": "261573.02", "total": "1896404.42", "maximum_subtotal": "0", "maximum_total": "0", "currency": "MXN" }, "open_contract_type": null, "quantity": null, "exercised_quantity": null, "participants": [], "line_items": [ { "number": "0", "cucop_code": "25501-0048", "description": "COLLECTION TUBES MARCA PROMEGA CATALOGO A130B PAQUETE 250 PIEZA PIEZA", "unit": "PIEZA", "requested_quantity": "83", "awarded_quantity": null, "unit_price": "9726.91", "subtotal": "807333.53", "tax": "129173.36", "other_taxes": null, "total": "936506.89", "cucop_description": "TUBO MUESTRADOR", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "MINICOLUMNS WIZARD SV GEL AND PCR CLEAN-UP SYSTEM MARCA PROMEGA CATALOGO A129B PAQUETE 250 PIEZA PIEZA", "unit": "PIEZA", "requested_quantity": "60", "awarded_quantity": null, "unit_price": "10289.12", "subtotal": "617347.2", "tax": "98775.55", "other_taxes": null, "total": "716122.75", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "MINICOLUMNS WIZARD Y COLLECTION TUBES MARCA PROMEGA CATALOGO A1460 PAQUETE PIEZA", "unit": "PIEZA", "requested_quantity": "21", "awarded_quantity": null, "unit_price": "9726.91", "subtotal": "204265.11", "tax": "32682.42", "other_taxes": null, "total": "236947.53", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" }, { "number": "0", "cucop_code": "25501-0120", "description": "WIZARD SV GEL MINICOLUMNS MARCA PROMEGA CATALOGO A9281 KIT PARA 50 REACCIONES PIEZA", "unit": "PIEZA", "requested_quantity": "2", "awarded_quantity": null, "unit_price": "2942.78", "subtotal": "5885.56", "tax": "941.69", "other_taxes": null, "total": "6827.25", "cucop_description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "partida_code": "25501", "partida_description": "MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO" } ] } ], "documents": [ { "id": null, "annex_number": 1, "document_type": null, "description": "JUSTIFICACIÓN DE EXCEPCIÓN", "filename": "JuExLP.pdf", "availability": "available", "size_bytes": "34758562", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T13:51:22.970Z", "updated_at": "2025-11-06T13:51:22.971Z" }, { "id": null, "annex_number": 1, "document_type": null, "description": "ANEXO TÉCNICO", "filename": "011-ATSUniparts.pdf", "availability": "available", "size_bytes": "4643252", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T13:51:31.052Z", "updated_at": "2025-11-06T13:51:31.053Z" }, { "id": null, "annex_number": 4, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "485Uniparts.pdf", "availability": "available", "size_bytes": "756363", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T13:51:37.185Z", "updated_at": "2025-11-06T13:51:37.186Z" }, { "id": null, "annex_number": 5, "document_type": null, "description": "OFICIO DE ADJUDICACIÓN", "filename": "476Uniparts.pdf", "availability": "available", "size_bytes": "743560", "mime_type": "application/pdf", "sha256": null, "uploaded_at": "2025-11-06T13:51:43.337Z", "updated_at": "2025-11-06T13:51:43.338Z" } ], "provenance": { "source_system": "Compras MX", "source_fetched_at": "2026-08-03T00:12:58.252Z", "last_seen_at": "2026-08-03T00:45:28.044Z", "first_seen_at": "2025-11-04T21:52:16.199Z", "detail_complete": true, "documents_complete": true, "content_changed_at": "2025-11-04T21:52:16.199Z" }, "context": { "prices": [ { "cucop_code": "25101-0037", "description": "REACTIVOS ANALITICOS", "priced_items": 44908, "units": [ { "n": 37743, "max": 280215502.56, "min": 0.53, "p10": 257, "p50": 3160, "p90": 19101.912, "unidad": "PIEZA" }, { "n": 3116, "max": 389753, "min": 2.25, "p10": 400, "p50": 2371.685, "p90": 18751.455, "unidad": "LITRO" }, { "n": 2930, "max": 1567806.8, "min": 1, "p10": 120, "p50": 3200, "p90": 17597.42, "unidad": "UNIDAD" }, { "n": 249, "max": 111832796, "min": 3.81, "p10": 885.8, "p50": 31540, "p90": 8964611.16, "unidad": "SERVICIO" }, { "n": 204, "max": 48058.42, "min": 140, "p10": 516.839, "p50": 15109.01, "p90": 33997.005, "unidad": "MILILITRO" }, { "n": 147, "max": 66620.51, "min": 0.75, "p10": 294.948, "p50": 1414, "p90": 7859.608, "unidad": "GRAMO" }, { "n": 142, "max": 68318.25, "min": 12.93, "p10": 72.992, "p50": 895.05, "p90": 5181.9, "unidad": "KILOGRAMO" }, { "n": 142, "max": 24971469.93, "min": 18, "p10": 1215.2, "p50": 65495.585, "p90": 457938.306, "unidad": "LOTE" }, { "n": 65, "max": 33900, "min": 208, "p10": 647.412, "p50": 2063.45, "p90": 5323.4, "unidad": "GALON" }, { "n": 59, "max": 120750, "min": 58.5, "p10": 112.396, "p50": 1561.88, "p90": 13849.984, "unidad": "TESLA" }, { "n": 58, "max": 21600, "min": 16.04, "p10": 22.329, "p50": 110.985, "p90": 691, "unidad": "METRO CUBICO" }, { "n": 28, "max": 12722.17, "min": 119, "p10": 698.229, "p50": 1903.5, "p90": 4866.035, "unidad": "MILIGRAMO" }, { "n": 25, "max": 103489.92, "min": 1617, "p10": 11250.8, "p50": 14200.9, "p90": 57843.788, "unidad": "KILOGRAMO POR HORA" } ], "price_by_year": { "2023": { "n": 14653, "p50": 2420 }, "2024": { "n": 13438, "p50": 3500 }, "2025": { "n": 8626, "p50": 4177.3 }, "2026": { "n": 8191, "p50": 2958 } }, "refreshed_at": "2026-09-24T05:35:01.565Z" }, { "cucop_code": "25101-0049", "description": "COMPUESTO QUIMICO", "priced_items": 9641, "units": [ { "n": 6803, "max": 446857.16, "min": 0.18, "p10": 210, "p50": 2220.54, "p90": 14850, "unidad": "PIEZA" }, { "n": 1458, "max": 234303.56, "min": 7.11, "p10": 262.741, "p50": 3321, "p90": 27897.261, "unidad": "LITRO" }, { "n": 417, "max": 107500, "min": 1.27, "p10": 13.99, "p50": 117.45, "p90": 1336.656, "unidad": "KILOGRAMO" }, { "n": 270, "max": 77586.21, "min": 72.08, "p10": 163.368, "p50": 2182.08, "p90": 12455.3, "unidad": "UNIDAD" }, { "n": 227, "max": 551727.59, "min": 46.64, "p10": 1238.41, "p50": 7942, "p90": 34884.178, "unidad": "LOTE" }, { "n": 225, "max": 28382.84, "min": 0.01, "p10": 0.6373, "p50": 830, "p90": 2675.328, "unidad": "GRAMO" }, { "n": 110, "max": 21415.86, "min": 0.01, "p10": 0.05, "p50": 119.92, "p90": 3655.8, "unidad": "MILILITRO" }, { "n": 79, "max": 179860, "min": 22, "p10": 274, "p50": 2340, "p90": 19000, "unidad": "METRO CUBICO" }, { "n": 26, "max": 16211, "min": 73, "p10": 120, "p50": 303.5, "p90": 2500.125, "unidad": "GALON" }, { "n": 17, "max": 35301000, "min": 95, "p10": 408, "p50": 77586.21, "p90": 8725440.398, "unidad": "SERVICIO" }, { "n": 3, "max": 7864, "min": 2271.25, "p10": 2292.4, "p50": 2377, "p90": 6766.6, "unidad": "MILIGRAMO" }, { "n": 3, "max": 13.99, "min": 13.99, "p10": 13.99, "p50": 13.99, "p90": 13.99, "unidad": "KILOMETRO" } ], "price_by_year": { "2023": { "n": 4558, "p50": 3176.215 }, "2024": { "n": 2176, "p50": 1743 }, "2025": { "n": 1994, "p50": 1379.41 }, "2026": { "n": 913, "p50": 1092 } }, "refreshed_at": "2026-09-25T21:00:03.055Z" }, { "cucop_code": "25501-0048", "description": "TUBO MUESTRADOR", "priced_items": 1252, "units": [ { "n": 1145, "max": 114987, "min": 0.54, "p10": 154.224, "p50": 579.08, "p90": 3960.4, "unidad": "PIEZA" }, { "n": 98, "max": 8348.6, "min": 1.57, "p10": 203.1, "p50": 635.325, "p90": 3979, "unidad": "UNIDAD" }, { "n": 6, "max": 6034.48, "min": 370.23, "p10": 825.085, "p50": 2131.55, "p90": 4612.065, "unidad": "LOTE" } ], "price_by_year": { "2023": { "n": 608, "p50": 462.5 }, "2024": { "n": 281, "p50": 560 }, "2025": { "n": 221, "p50": 955 }, "2026": { "n": 142, "p50": 649.01 } }, "refreshed_at": "2026-09-18T22:38:29.055Z" }, { "cucop_code": "25501-0120", "description": "COLUMNA PARA CROMATOGRAFIA DE GASES", "priced_items": 235, "units": [ { "n": 218, "max": 119560, "min": 70, "p10": 2133.332, "p50": 16775.36, "p90": 43309.494, "unidad": "PIEZA" }, { "n": 9, "max": 34154, "min": 6645, "p10": 8689, "p50": 14976, "p90": 29050, "unidad": "UNIDAD" }, { "n": 5, "max": 34353.94, "min": 230.55, "p10": 282.418, "p50": 404.72, "p90": 27868.316, "unidad": "METRO" } ], "price_by_year": { "2023": { "n": 70, "p50": 17769.5 }, "2024": { "n": 81, "p50": 17587 }, "2025": { "n": 57, "p50": 16610.07 }, "2026": { "n": 27, "p50": 3601.57 } }, "refreshed_at": "2026-09-18T22:38:31.345Z" } ], "suppliers": [ { "slug": "uniparts", "name": "UNIPARTS SA DE CV", "total_contracts": 198, "total_awarded_amount": "38076889.14", "median_amount": "66347.69", "distinct_buyers": 33, "first_contract_at": "2023-02-03T00:00:00.000Z", "last_contract_at": "2025-12-16T00:00:00.000Z", "with_this_buyer": { "contracts": 12, "amount": "11351646.93" }, "refreshed_at": "2026-09-16T00:56:30.797Z" } ], "buyer": { "slug": "senasica", "name": "SERVICIO NACIONAL DE SANIDAD, INOCUIDAD Y CALIDAD AGROALIMENTARIA", "total_procedures": 504, "distinct_suppliers": 321, "procedures_by_type": { "LICITACIÓN PÚBLICA": 103, "ADJUDICACIÓN DIRECTA": 283, "INVITACIÓN A CUANDO MENOS TRES PERSONAS": 115, "CONTRATO ESPECÍFICO DERIVADO DE ACUERDO MARCO": 3 }, "refreshed_at": "2026-09-24T00:15:06.112Z" } }, "alternates": [], "similar": [ { "numero_procedimiento": "aa-08-b00-008b00001-n-57-2023", "nombre_procedimiento": "ADQUISICIÓN DE PRODUCTOS QUÍMICOS Y MATERIAL Y ACCESORIOS DE LABORATORIO CENAPA", "dependencia": "SENASICA", "siglas": "SENASICA", "score": 0.12472295761107777, "anio_ejercicio": 2023, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2023-05-29T12:11:39.000Z", "ganador": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "ganador_slug": "agilent-technologies-mexico", "ganador_rfc_type": null, "ganadores": "12", "monto_mxn": "16222570.90" }, { "numero_procedimiento": "aa-08-b00-008b00001-n-103-2025", "nombre_procedimiento": "PRODUCTOS QUÍMICOS BÁSICOS Y MATERIALES PARA LABORATORIO CENAPA VARIAS MARCAS", "dependencia": "SENASICA", "siglas": "SENASICA", "score": 0.12637004223583503, "anio_ejercicio": 2025, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2025-05-08T11:50:47.000Z", "ganador": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "ganador_slug": "applied-biosystems-de-mexico", "ganador_rfc_type": null, "ganadores": "2", "monto_mxn": "1453671.27" }, { "numero_procedimiento": "aa-08-b00-008b00001-n-66-2025", "nombre_procedimiento": "PRODUCTOS QUÍMICOS BÁSICOS LABORATORIOS CNRF APPLIED B. INVITROGEN Y THERMO F.)", "dependencia": "SERVICIO NACIONAL DE SANIDAD, INOCUIDAD Y CALIDAD AGROALIMENTARIA", "siglas": "SENASICA", "score": 0.1390316742947164, "anio_ejercicio": 2025, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2025-04-07T12:43:11.000Z", "ganador": "APPLIED BIOSYSTEMS DE MEXICO S DE RL DE CV", "ganador_slug": "applied-biosystems-de-mexico", "ganador_rfc_type": null, "ganadores": "2", "monto_mxn": "7460810.89" }, { "numero_procedimiento": "aa-08-b00-008b00001-n-53-2025", "nombre_procedimiento": "PRODUCTOS QUÍMICOS BÁSICOS LABORATORIOS CNRF ((PROMEGA, IDT Y CLONTECH - TAKARA)", "dependencia": "SERVICIO NACIONAL DE SANIDAD, INOCUIDAD Y CALIDAD AGROALIMENTARIA", "siglas": "SENASICA", "score": 0.14045390955437698, "anio_ejercicio": 2025, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2025-04-07T12:37:26.000Z", "ganador": "UNIPARTS SA DE CV", "ganador_slug": "uniparts", "ganador_rfc_type": null, "ganadores": "1", "monto_mxn": "1760766.70" }, { "numero_procedimiento": "aa-08-b00-008b00001-n-41-2024", "nombre_procedimiento": "MATERIALES, ACCESORIOS DE LABORATORIO Y PRODUCTOS QUÍMICOS PARA EL CENAPA 2024", "dependencia": "SENASICA", "siglas": "SENASICA", "score": 0.15037694864685114, "anio_ejercicio": 2024, "estatus": "ADJUDICADO", "fecha_fallo": null, "fecha_publicacion": "2024-04-25T16:43:15.000Z", "ganador": "AGILENT TECHNOLOGIES MEXICO S DE RL DE CV", "ganador_slug": "agilent-technologies-mexico", "ganador_rfc_type": null, "ganadores": "13", "monto_mxn": "13967975.65" }, { "numero_procedimiento": "aa-12-ncd-012ncd001-i-208-2025", "nombre_procedimiento": "REACTIVOS EXPERIMENTALES PARA CONTINUIDAD DE PROTOCOLOS DE INVESTIGACION", "dependencia": "INER", "siglas": "INER", "score": 0.1625593900680482, "anio_ejercicio": 2025, "estatus": "ADJUDICADO PARCIAL", "fecha_fallo": null, "fecha_publicacion": "2025-07-15T16:28:34.000Z", "ganador": "ABALAT SA DE CV", "ganador_slug": "abalat", "ganador_rfc_type": null, "ganadores": "10", "monto_mxn": "3307495.86" } ] }